| Allele Name | tm3148 |
| Allele Type | 通常株 |
| Sequence Name | F56A3.1 |
| Gene Name | fncm-1 |
| Worm Base | Allele Name |
tm3148
|
| Gene Name |
fncm-1
|
| Sequence |
F56A3.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. H-S. Koo: the germ cells are hypersensitive to interstrand DNA crosslinking. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 19258/19259-19768/19769 (510 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(19119..19426, 19498..19585, 19635..19744, 19791..20091, 20585..20727, 20772..21211, 21260..21435, 21637..21816, 21866..21954, 22000..22125, 22521..22626, 22887..22985, 23034..23137, 24012..24093) |
| Map position | -0.29 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CTGTGCAAGTTGACGTGCAG,IntFwd:CGTATTTCGGCGCCTCACTC,ExtRev:ATCGAAGCTGTACGACGAGA,IntRev:TCTTGCGTGCTCATCGGGTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621
[ PubMed ID = 32414869 ]
[ RRC reference ]
|
Kim HM, Beese-Sims SE, Colaiácovo MP.
Fanconi Anemia FANCM/FNCM-1 and FANCD2/FCD-2 Are Required for Maintaining Histone Methylation Levels and Interact with the Histone Demethylase LSD1/SPR-5 in Caenorhabditis elegans.
Genetics 2018 209(2) 409-423
[ PubMed ID = 29588287 ]
[ RRC reference ]
|
Lee KY, Chung KY, Koo HS.
The involvement of FANCM, FANCI, and checkpoint proteins in the interstrand DNA crosslink repair pathway is conserved in C. elegans.
DNA Repair (Amst) 2010 9(4) 374-82
[ PubMed ID = 20075016 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.