分離済み変異体

tm3124

Allele Name

tm3124

Balance

Not Required

OutCross

Not Accepted

Sequence Name

Y55D9A.1

Gene Name

efa-6

Worm Base

Allele Name

tm3124

Gene Name

efa-6

Sequence

Y55D9A.1

Phenotype

homozygous viable. Dr. O. Blacque: dye-filling normal.

Mutation site

10863/10864-11434/11435 (571 bp deletion)

Chromosome

Putative gene structure

complement(join(6732..6917, 7587..8092, 10496..11028, 11082..11265, 11384..11618, 11923..12044, 12428..12580, 14018..14257, 14678..14825, 15198..15347))

Map position

6.09

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CTCTTTCCACCATCAGTCTC,ExtRev:GGACACTCCGTCGAAACATT,IntFwd:GTTGTGGCTGCCGTCTTGAT,IntRev:CCGTCGAAACATTCAGTGGT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Ko SH, Cho KA, Li X, Ran Q, Liu Z, Chen L.
GPX modulation promotes regenerative axonal fusion and functional recovery after injury through PSR-1 condensation.
Nat Commun 2025 16(1) 1079
[ PubMed ID = 39870634 ] [ RRC reference ]

Sandhu A, Lyu X, Wan X, Meng X, Tang NH, Gonzalez G, Syed IN, Chen L, Jin Y, Chisholm AD.
The microtubule regulator EFA-6 forms cortical foci dependent on its intrinsically disordered region and interactions with tubulins.
Cell Rep 2024 43(10) 114776
[ PubMed ID = 39305484 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Xu A, Zhang Z, Ko SH, Fisher AL, Liu Z, Chen L.
Microtubule regulators act in the nervous system to modulate fat metabolism and longevity through DAF-16 in C. elegans.
Aging Cell 2019 18(2) e12884
[ PubMed ID = 30638295 ] [ RRC reference ]

Noblett N, Wu Z, Ding ZH, Park S, Roenspies T, Flibotte S, Chisholm AD, Jin Y, Colavita A.
DIP-2 suppresses ectopic neurite sprouting and axonal regeneration in mature neurons.
J Cell Biol 2019 218(1) 125-133
[ PubMed ID = 30396999 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460
[ PubMed ID = 27764672 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5
[ PubMed ID = 27661253 ] [ RRC reference ]

Chen L, Chuang M, Koorman T, Boxem M, Jin Y, Chisholm AD.
Axon injury triggers EFA-6 mediated destabilization of axonal microtubules via TACC and doublecortin like kinase.
Elife 2015 4
[ PubMed ID = 26339988 ] [ RRC reference ]

Teuliere J, Cordes S, Singhvi A, Talavera K, Garriga G.
Asymmetric neuroblast divisions producing apoptotic cells require the cytohesin GRP-1 in Caenorhabditis elegans.
Genetics 2014 198(1) 229-47
[ PubMed ID = 25053664 ] [ RRC reference ]

Chen L, Wang Z, Ghosh-Roy A, Hubert T, Yan D, O'Rourke S, Bowerman B, Wu Z, Jin Y, Chisholm AD.
Axon regeneration pathways identified by systematic genetic screening in C. elegans.
Neuron 2011 71(6) 1043-57
[ PubMed ID = 21943602 ] [ RRC reference ]

O'Rourke SM, Christensen SN, Bowerman B.
Caenorhabditis elegans EFA-6 limits microtubule growth at the cell cortex.
Nat Cell Biol 2010 12(12) 1235-41
[ PubMed ID = 21076413 ] [ RRC reference ]