分離済み変異体

tm3121

Allele Nametm3121
BalanceNot Required
OutCrossNot Accepted
Sequence NameF23D12.5
Gene Namejmjd-3.2
Worm BaseAllele Name tm3121
Gene Name jmjd-3.2
Sequence F23D12.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. R.H. Horvitz: pharyngeal morphology normal. Dr. Hongkyun Kim: normal locomotion. Dr. M. Han: normal vulval phenotype. Dr. S. Kennedy: normal RNAi
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 35610/35611-AATTTTTTAATAA-35966/35967 (356 bp deletion + 13 bp insertion)
ChromosomeX
Putative gene structurejoin(34558..34669, 35233..35472, 35659..36149, 36785..37490, 37936..38123, 38170..38762, 38819..39010, 39635..39716)
Map position16.7
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGTTAGAATCCGAGTCTCA,ExtRev:AGGGTCAGTAGGTTTACAAC,ExtFwd:TCGAGTGGATCAGTGCTTCG,IntRev:ACTCTAGAATCGTACCAGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800 
[ PubMed ID = 36516753 ] [ RRC reference ]

Zaghet N, Madsen K, Rossi F, Perez DF, Amendola PG, Demharter S, Pfisterer U, Khodosevich K, Pasini D, Salcini AE.
Coordinated maintenance of H3K36/K27 methylation by histone demethylases preserves germ cell identity and immortality.
Cell Rep 2021 37(8) 110050 
[ PubMed ID = 34818537 ] [ RRC reference ]

Guillermo ARR, Chocian K, Gavriilidis G, Vandamme J, Salcini AE, Mellor J, Woollard A.
H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner.
BMC Biol 2021 19(1) 59 
[ PubMed ID = 33766022 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristizábal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colaiácovo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]