Allele Name | tm3110 |
Allele Type | 通常株 |
Sequence Name | Y49E10.11 |
Gene Name | tat-1 |
Worm Base | Allele Name |
tm3110
|
Gene Name |
tat-1
|
Sequence |
Y49E10.11
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. M. Han: normal morphology and fatty acid composition. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 50890/50891 (TATTANAATGCCCANTTTCCCGNTGNTTGCCCACTGA-51571/51572 (681 bp deletion + 37 bp insertion) |
Chromosome | III |
Putative gene structure | complement(join(31959..32056, 32642..32766, 37381..37473, 38318..38574, 39898..40038, 40248..40381, 40524..40678, 42286..42815, 44720..45258, 46349..46649, 47456..47568, 48159..48398, 50066..50372, 51442..51627, 52670..52769, 52820..52877, 53218..53260)) |
Map position | 17.57 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:AAAGCAGCTGATCAATACCG,IntFwd:TCAATACCGAAATGTCTGGC,ExtRev:TCCCCACACAGAGTGTAGTC,IntRev:GACGTTAGCCCGACTGGAAG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Qu Z, Ji S, Zheng S. BRAF Controls the Effects of Metformin on Neuroblast Cell Divisions in C. elegans. Int J Mol Sci 2020 22(1)
[ PubMed ID = 33375360 ]
[ RRC reference ]
|
Li X, Chen B, Yoshina S, Cai T, Yang F, Mitani S, Wang X. Inactivation of Caenorhabditis elegans aminopeptidase DNPP-1 restores endocytic sorting and recycling in tat-1 mutants. Mol Biol Cell 2013 24(8) 1163-75
[ PubMed ID = 23427264 ]
[ RRC reference ]
|
|