分離済み変異体

tm311

Allele Nametm311
BalanceNot Required
OutCrossNot Accepted
Sequence NameR03E9.1
Gene Namemdl-1
Worm BaseAllele Name tm311
Gene Name mdl-1
Sequence R03E9.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. B. Conradt: slow growth at 15?C (possibly lethal). Dr. L. Mathies: fertile, locomotion normal, no obvious morphological defects. Dr. O. Hobert: ASE & AIY fate markers normal. Dr. J. Kaplan: non-Egl, non-Unc.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12683/12684-13151/13152 (468 bp deletion)
ChromosomeX
Putative gene structurejoin(12508..12661, 12711..12991, 13281..13691)
Map position-2.63
Balancer
Map position of balancer
Sequence of primersIntRev:TTTGCCGGGGTTTCCCATGT,IntFwd:TGTAACCGGCGAATATTGTC,ExtRev:GCCTGTGATAGCGAATCTAT,ExtFwd:GCAAAGGACGTTTCGCAAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Otarigho B, Aballay A.
Immunity-longevity tradeoff neurally controlled by GABAergic transcription factor PITX1/UNC-30.
Cell Rep 2021 35(8) 109187 
[ PubMed ID = 34038721 ] [ RRC reference ]

Shimizu T, Pastuhov SI, Hanafusa H, Sakai Y, Todoroki Y, Hisamoto N, Matsumoto K.
Caenorhabditis elegans F-Box Protein Promotes Axon Regeneration by Inducing Degradation of the Mad Transcription Factor.
J Neurosci 2021 41(11) 2373-2381 
[ PubMed ID = 33514673 ] [ RRC reference ]

Sakai Y, Hanafusa H, Pastuhov SI, Shimizu T, Li C, Hisamoto N, Matsumoto K.
TDP2 negatively regulates axon regeneration by inducing SUMOylation of an Ets transcription factor.
EMBO Rep 2019 20(10) e47517 
[ PubMed ID = 31393064 ] [ RRC reference ]

Botts MR, Cohen LB, Probert CS, Wu F, Troemel ER.
Microsporidia Intracellular Development Relies on Myc Interaction Network Transcription Factors in the Host.
G3 (Bethesda) 2016 6(9) 2707-16 
[ PubMed ID = 27402359 ] [ RRC reference ]

Nakamura S, Karalay Ö, Jäger PS, Horikawa M, Klein C, Nakamura K, Latza C, Templer SE, Dieterich C, Antebi A.
Mondo complexes regulate TFEB via TOR inhibition to promote longevity in response to gonadal signals.
Nat Commun 2016 7 10944 
[ PubMed ID = 27001890 ] [ RRC reference ]

Johnson DW, Llop JR, Farrell SF, Yuan J, Stolzenburg LR, Samuelson AV.
The Caenorhabditis elegans Myc-Mondo/Mad complexes integrate diverse longevity signals.
PLoS Genet 2014 10(4) e1004278 
[ PubMed ID = 24699255 ] [ RRC reference ]

Riesen M, Feyst I, Rattanavirotkul N, Ezcurra M, Tullet JM, Papatheodorou I, Ziehm M, Au C, Gilliat AF, Hellberg J, Thornton JM, Gems D.
MDL-1, a growth- and tumor-suppressor, slows aging and prevents germline hyperplasia and hypertrophy in C. elegans.
Aging (Albany NY) 2014 6(2) 98-117 
[ PubMed ID = 24531613 ] [ RRC reference ]

Coburn C, Allman E, Mahanti P, Benedetto A, Cabreiro F, Pincus Z, Matthijssens F, Araiz C, Mandel A, Vlachos M, Edwards SA, Fischer G, Davidson A, Pryor RE, Stevens A, Slack FJ, Tavernarakis N, Braeckman BP, Schroeder FC, Nehrke K, Gems D.
Anthranilate fluorescence marks a calcium-propagated necrotic wave that promotes organismal death in C. elegans.
PLoS Biol 2013 11(7) e1001613 
[ PubMed ID = 23935448 ] [ RRC reference ]

Ackerman D, Gems D.
Insulin/IGF-1 and hypoxia signaling act in concert to regulate iron homeostasis in Caenorhabditis elegans.
PLoS Genet 2012 8(3) e1002498 
[ PubMed ID = 22396654 ] [ RRC reference ]