分離済み変異体

tm3100

Allele Nametm3100
BalanceNot Required
OutCrossNot Accepted
Sequence NameC09G5.8
Gene NameC09G5.8
Worm BaseAllele Name tm3100
Gene Name C09G5.8
Sequence C09G5.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: Dyf (+). Dr. K. Ashrafi: non-Gro.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26722/26723-27262/27263 (540 bp deletion)
ChromosomeII
Putative gene structurejoin(24056..24159, 24467..24576, 24694..24835, 24885..24951, 25049..25173, 26121..26246, 26614..26913, 26993..27125, 27180..27547, 27861..28121, 29490..29688, Z46792.1:109..204, Z46792.1:256..426, Z46792.1:664..882, Z46792.1:1065..1283, Z46792.1:2577..2846, Z46792.1:3000..3449, Z46792.1:3497..3600, Z46792.1:3647..4197, Z46792.1:4282..4608, Z46792.1:5030..5200, Z46792.1:5252..5334)
Map position2.84
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGCATAGGGAGAGATAATA,IntFwd:AATTCCAGGGTATCCGCAAG,ExtRev:GATCTTCACGACGTCTGTGT,IntRev:ATACTTTCCCGTGCTCCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Cevik S, Peng X, Beyer T, Pir MS, Yenisert F, Woerz F, Hoffmann F, Altunkaynak B, Pir B, Boldt K, Karaman A, Cakiroglu M, Oner SS, Cao Y, Ueffing M, Kaplan OI.
WDR31 displays functional redundancy with GTPase-activating proteins (GAPs) ELMOD and RP2 in regulating IFT complex and recruiting the BBSome to cilium.
Life Sci Alliance 2023 6(8)  
[ PubMed ID = 37208194 ] [ RRC reference ]

Kaplan OI.
RPI-1 (human DCDC2) displays functional redundancy with Nephronophthisis 4 in regulating cilia biogenesis in C. elegans.
Turk J Biol 2023 47(1) 74-83 
[ PubMed ID = 37529113 ] [ RRC reference ]

De-Castro ARG, Rodrigues DRM, De-Castro MJG, Vieira N, Vieira C, Carvalho AX, Gassmann R, Abreu CMC, Dantas TJ.
WDR60-mediated dynein-2 loading into cilia powers retrograde IFT and transition zone crossing.
J Cell Biol 2022 221(1)  
[ PubMed ID = 34739033 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

van Dam TJP, Kennedy J, van der Lee R, de Vrieze E, Wunderlich KA, Rix S, Dougherty GW, Lambacher NJ, Li C, Jensen VL, Leroux MR, Hjeij R, Horn N, Texier Y, Wissinger Y, van Reeuwijk J, Wheway G, Knapp B, Scheel JF, Franco B, Mans DA, van Wijk E, Képès F, Slaats GG, Toedt G, Kremer H, Omran H, Szymanska K, Koutroumpas K, Ueffing M, Nguyen TT, Letteboer SJF, Oud MM, van Beersum SEC, Schmidts M, Beales PL, Lu Q, Giles RH, Szklarczyk R, Russell RB, Gibson TJ, Johnson CA, Blacque OE, Wolfrum U, Boldt K, Roepman R, Hernandez-Hernandez V, Huynen MA.
CiliaCarta: An integrated and validated compendium of ciliary genes.
PLoS One 2019 14(5) e0216705 
[ PubMed ID = 31095607 ] [ RRC reference ]

Jensen VL, Carter S, Sanders AA, Li C, Kennedy J, Timbers TA, Cai J, Scheidel N, Kennedy BN, Morin RD, Leroux MR, Blacque OE.
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.
PLoS Genet 2016 12(12) e1006469 
[ PubMed ID = 27930654 ] [ RRC reference ]

Wei Q, Zhang Y, Schouteden C, Zhang Y, Zhang Q, Dong J, Wonesch V, Ling K, Dammermann A, Hu J.
The hydrolethalus syndrome protein HYLS-1 regulates formation of the ciliary gate.
Nat Commun 2016 7 12437 
[ PubMed ID = 27534274 ] [ RRC reference ]

Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, Lopez E, Rivière JB, Faivre L, Thauvin-Robinet C, Reiter JF, Blacque OE, Valente EM, Leroux MR.
MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone.
PLoS Biol 2016 14(3) e1002416 
[ PubMed ID = 26982032 ] [ RRC reference ]

Masyukova SV, Landis DE, Henke SJ, Williams CL, Pieczynski JN, Roszczynialski KN, Covington JE, Malarkey EB, Yoder BK.
A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4.
PLoS Genet 2016 12(2) e1005841 
[ PubMed ID = 26863025 ] [ RRC reference ]

Sanders AA, de Vrieze E, Alazami AM, Alzahrani F, Malarkey EB, Sorusch N, Tebbe L, Kuhns S, van Dam TJ, Alhashem A, Tabarki B, Lu Q, Lambacher NJ, Kennedy JE, Bowie RV, Hetterschijt L, van Beersum S, van Reeuwijk J, Boldt K, Kremer H, Kesterson RA, Monies D, Abouelhoda M, Roepman R, Huynen MH, Ueffing M, Russell RB, Wolfrum U, Yoder BK, van Wijk E, Alkuraya FS, Blacque OE.
KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome.
Genome Biol 2015 16 293 
[ PubMed ID = 26714646 ] [ RRC reference ]

Jensen VL, Li C, Bowie RV, Clarke L, Mohan S, Blacque OE, Leroux MR.
Formation of the transition zone by Mks5/Rpgrip1L establishes a ciliary zone of exclusion (CIZE) that compartmentalises ciliary signalling proteins and controls PIP2 ciliary abundance.
EMBO J 2015 34(20) 2537-56 
[ PubMed ID = 26392567 ] [ RRC reference ]

Roberson EC, Dowdle WE, Ozanturk A, Garcia-Gonzalo FR, Li C, Halbritter J, Elkhartoufi N, Porath JD, Cope H, Ashley-Koch A, Gregory S, Thomas S, Sayer JA, Saunier S, Otto EA, Katsanis N, Davis EE, Attié-Bitach T, Hildebrandt F, Leroux MR, Reiter JF.
TMEM231, mutated in orofaciodigital and Meckel syndromes, organizes the ciliary transition zone.
J Cell Biol 2015 209(1) 129-42 
[ PubMed ID = 25869670 ] [ RRC reference ]

Nguyen PA, Liou W, Hall DH, Leroux MR.
Ciliopathy proteins establish a bipartite signaling compartment in a C. elegans thermosensory neuron.
J Cell Sci 2014 127(Pt 24) 5317-30 
[ PubMed ID = 25335890 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Huang L, Szymanska K, Jensen VL, Janecke AR, Innes AM, Davis EE, Frosk P, Li C, Willer JR, Chodirker BN, Greenberg CR, McLeod DR, Bernier FP, Chudley AE, Müller T, Shboul M, Logan CV, Loucks CM, Beaulieu CL, Bowie RV, Bell SM, Adkins J, Zuniga FI, Ross KD, Wang J, Ban MR, Becker C, Nürnberg P, Douglas S, Craft CM, Akimenko MA, Hegele RA, Ober C, Utermann G, Bolz HJ, Bulman DE, Katsanis N, Blacque OE, Doherty D, Parboosingh JS, Leroux MR, Johnson CA, Boycott KM.
TMEM237 is mutated in individuals with a Joubert syndrome related disorder and expands the role of the TMEM family at the ciliary transition zone.
Am J Hum Genet 2011 89(6) 713-30 
[ PubMed ID = 22152675 ] [ RRC reference ]

Liu L, Zhang M, Xia Z, Xu P, Chen L, Xu T.
Caenorhabditis elegans ciliary protein NPHP-8, the homologue of human RPGRIP1L, is required for ciliogenesis and chemosensation.
Biochem Biophys Res Commun 2011 410(3) 626-31 
[ PubMed ID = 21689635 ] [ RRC reference ]

Williams CL, Li C, Kida K, Inglis PN, Mohan S, Semenec L, Bialas NJ, Stupay RM, Chen N, Blacque OE, Yoder BK, Leroux MR.
MKS and NPHP modules cooperate to establish basal body/transition zone membrane associations and ciliary gate function during ciliogenesis.
J Cell Biol 2011 192(6) 1023-41 
[ PubMed ID = 21422230 ] [ RRC reference ]