Home > 分離済み変異体 > tm3082

分離済み変異体

Allele Name		tm3082
Balance		Not Required
OutCross		Not Accepted
Sequence Name		Y39A3B.5
Gene Name		ckr-2
Worm Base	Allele Name	tm3082
	Gene Name	ckr-2
	Sequence	Y39A3B.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. L. Schoofs: Endocrinology 149, 2826 (2008)
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		32833/32834-33402/33403 (569 bp deletion)
Chromosome		III
Putative gene structure		complement(join(30198..30629, 31620..31710, 31767..31883, 31936..32023, 32608..33082, 33756..33906, 34329..34428, 34649..34808, 35083..35217))
Map position		-15.86
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ACCTGGCGGGGGAAACAACA,IntFwd:CACTCCATCACTACGACAGT,ExtRev:CCGTCAGCGAAATCTATCGT,IntRev:AGATCCCACGCCTACGCAAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Kramer TS, Wan FK, Pugliese SM, Atanas AA, Hiser AW, Luo J, Bueno E, Flavell SW. Neural Sequences Underlying Directed Turning in C. elegans. bioRxiv 2024    [ PubMed ID = 39149398 ] [ RRC reference ] Hernandez-Cravero B, Gallino S, Florman J, Vranych C, Diaz P, Elgoyhen AB, Alkema MJ, de Mendoza D. Cannabinoids activate the insulin pathway to modulate mobilization of cholesterol in C. elegans. PLoS Genet 2022 18(11) e1010346  [ PubMed ID = 36346800 ] [ RRC reference ] Chai CM, Park H, Sternberg PW. Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision. Curr Biol 2022 32(15) 3365-3373.e6  [ PubMed ID = 35679871 ] [ RRC reference ] Ramachandran S, Banerjee N, Bhattacharya R, Lemons ML, Florman J, Lambert CM, Touroutine D, Alexander K, Schoofs L, Alkema MJ, Beets I, Francis MM. A conserved neuropeptide system links head and body motor circuits to enable adaptive behavior. Elife 2021 10   [ PubMed ID = 34766905 ] [ RRC reference ] Pandey P, Singh A, Kaur H, Ghosh-Roy A, Babu K. Increased dopaminergic neurotransmission results in ethanol dependent sedative behaviors in Caenorhabditis elegans. PLoS Genet 2021 17(2) e1009346  [ PubMed ID = 33524034 ] [ RRC reference ] Tao L, Porto D, Li Z, Fechner S, Lee SA, Goodman MB, Xu XZS, Lu H, Shen K. Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans. Dev Cell 2019 51(5) 617-631.e3  [ PubMed ID = 31735664 ] [ RRC reference ] Bhattacharya R, Touroutine D, Barbagallo B, Climer J, Lambert CM, Clark CM, Alkema MJ, Francis MM. A conserved dopamine-cholecystokinin signaling pathway shapes context-dependent Caenorhabditis elegans behavior. PLoS Genet 2014 10(8) e1004584  [ PubMed ID = 25167143 ] [ RRC reference ] Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R. Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans. J Neurosci 2013 33(35) 14107-16  [ PubMed ID = 23986246 ] [ RRC reference ] Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y. Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans. PLoS Genet 2013 9(5) e1003472  [ PubMed ID = 23658528 ] [ RRC reference ] Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R. Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans. EMBO J 2012 31(3) 667-78  [ PubMed ID = 22124329 ] [ RRC reference ] Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L. Neuropeptide GPCRs in C. elegans. Front Endocrinol (Lausanne) 2012 3 167  [ PubMed ID = 23267347 ] [ RRC reference ] Hu Z, Pym EC, Babu K, Vashlishan Murray AB, Kaplan JM. A neuropeptide-mediated stretch response links muscle contraction to changes in neurotransmitter release. Neuron 2011 71(1) 92-102  [ PubMed ID = 21745640 ] [ RRC reference ] Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW. The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission. J Neurosci 2010 30(23) 7889-99  [ PubMed ID = 20534837 ] [ RRC reference ] Matus DQ, Li XY, Durbin S, Agarwal D, Chi Q, Weiss SJ, Sherwood DR. In vivo identification of regulators of cell invasion across basement membranes. Sci Signal 2010 3(120) ra35  [ PubMed ID = 20442418 ] [ RRC reference ] Janssen T, Meelkop E, Lindemans M, Verstraelen K, Husson SJ, Temmerman L, Nachman RJ, Schoofs L. Discovery of a cholecystokinin-gastrin-like signaling system in nematodes. Endocrinology 2008 149(6) 2826-39  [ PubMed ID = 18339709 ] [ RRC reference ]