分離済み変異体

tm3080

Allele Nametm3080
BalanceNot Required
OutCrossNot Accepted
Sequence NameC18F3.4
Gene Namensy-7
Worm BaseAllele Name tm3080
Gene Name nsy-7
Sequence C18F3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31096/31097-31565/31566 (469 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(29678..29869, 30375..30506, 30743..30898, 31373..31699, 32158..32271))
Map position3.6
Balancer
Map position of balancer
Sequence of primersExtFwd:CATGGGATAAGGTTGGTAAC,IntFwd:CCTAGTTTCAGAGCTGGGAG,ExtRev:TGTAGGGCTCAAGGAGGATG,IntRev:CCCTTGACTGGCATCAACGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Brown VE, Bradley E, Asaed TA, Lo SB, Bellini ZS, Blackett DJ, Callaway JJ, Hallesy J, Joshlin ZE, Kaneko TL, Kaneshiro CH, Kidd KR, Lee J, Leung KM, Li JS, Luo BP, Mbaeri CC, O'Neill A, Omomofe P, Schmidt JD, Truong M, Glater EE.
The AWC OFF neuron is important for attraction to 1-butanol in Caenorhabditis elegans.
MicroPubl Biol 2025 2025  
[ PubMed ID = 39882098 ] [ RRC reference ]

Worthy SE, Rojas GL, Taylor CJ, Glater EE.
Identification of Odor Blend Used by Caenorhabditis elegans for Pathogen Recognition.
Chem Senses 2018 43(3) 169-180 
[ PubMed ID = 29373666 ] [ RRC reference ]

Kotera I, Tran NA, Fu D, Kim JH, Byrne Rodgers J, Ryu WS.
Pan-neuronal screening in Caenorhabditis elegans reveals asymmetric dynamics of AWC neurons is critical for thermal avoidance behavior.
Elife 2016 5  
[ PubMed ID = 27849153 ] [ RRC reference ]

Lesch BJ, Gehrke AR, Bulyk ML, Bargmann CI.
Transcriptional regulation and stabilization of left-right neuronal identity in C. elegans.
Genes Dev 2009 23(3) 345-58 
[ PubMed ID = 19204119 ] [ RRC reference ]