| Allele Name | tm3077 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y73B6BL.7 |
| Gene Name | csp-2 |
| Worm Base | Allele Name |
tm3077
|
| Gene Name |
csp-2
|
| Sequence |
Y73B6BL.7
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 28927/28928-29244/29245 (317 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(21611..21668, 21717..21761, 23028..23173, 23521..23670, 23772..23958, 24486..25184, 25323..25400, 25454..25522, 25838..25948, 26210..26320, 28295..28545, 28591..28792, 28840..28934, 28979..29215, 29258..29299) |
| Map position | 3.15 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CACGTCATTTCTAGACGTCG,ExtRev:ATACTGATCACCGAGGCCAT,ExtFwd:GCCGGGCTATCATAATTAAC,IntFwd:ACGTTTGGGATATCAGTCGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Flowers S, Kothari R, Torres Cleuren YN, Alcorn MR, Ewe CK, Alok G, Fiallo SL, Joshi PM, Rothman JH. Regulation of defective mitochondrial DNA accumulation and transmission in C. elegans by the programmed cell death and aging pathways. Elife 2023 12
[ PubMed ID = 37782016 ]
[ RRC reference ]
|
Jeong PY, Kumar A, Joshi PM, Rothman JH. Intertwined Functions of Separase and Caspase in Cell Division and Programmed Cell Death. Sci Rep 2020 10(1) 6159
[ PubMed ID = 32273538 ]
[ RRC reference ]
|
Wang H, Lu Q, Cheng S, Wang X, Zhang H. Autophagy activity contributes to programmed cell death in Caenorhabditis elegans. Autophagy 2013 9(12) 1975-82
[ PubMed ID = 24185352 ]
[ RRC reference ]
|
Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC. C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase. PLoS One 2012 7(5) e36584
[ PubMed ID = 22590572 ]
[ RRC reference ]
|
Geng X, Zhou QH, Kage-Nakadai E, Shi Y, Yan N, Mitani S, Xue D. Caenorhabditis elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells. Cell Death Differ 2009 16(10) 1385-94
[ PubMed ID = 19575016 ]
[ RRC reference ]
|
|