分離済み変異体

tm3077

Allele Nametm3077
BalanceNot Required
OutCrossNot Accepted
Sequence NameY73B6BL.7
Gene Namecsp-2
Worm BaseAllele Name tm3077
Gene Name csp-2
Sequence Y73B6BL.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28927/28928-29244/29245 (317 bp deletion)
ChromosomeIV
Putative gene structurejoin(21611..21668, 21717..21761, 23028..23173, 23521..23670, 23772..23958, 24486..25184, 25323..25400, 25454..25522, 25838..25948, 26210..26320, 28295..28545, 28591..28792, 28840..28934, 28979..29215, 29258..29299)
Map position3.15
Balancer
Map position of balancer
Sequence of primersIntRev:CACGTCATTTCTAGACGTCG,ExtRev:ATACTGATCACCGAGGCCAT,ExtFwd:GCCGGGCTATCATAATTAAC,IntFwd:ACGTTTGGGATATCAGTCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Flowers S, Kothari R, Torres Cleuren YN, Alcorn MR, Ewe CK, Alok G, Fiallo SL, Joshi PM, Rothman JH.
Regulation of defective mitochondrial DNA accumulation and transmission in C. elegans by the programmed cell death and aging pathways.
Elife 2023 12  
[ PubMed ID = 37782016 ] [ RRC reference ]

Jeong PY, Kumar A, Joshi PM, Rothman JH.
Intertwined Functions of Separase and Caspase in Cell Division and Programmed Cell Death.
Sci Rep 2020 10(1) 6159 
[ PubMed ID = 32273538 ] [ RRC reference ]

Wang H, Lu Q, Cheng S, Wang X, Zhang H.
Autophagy activity contributes to programmed cell death in Caenorhabditis elegans.
Autophagy 2013 9(12) 1975-82 
[ PubMed ID = 24185352 ] [ RRC reference ]

Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC.
C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase.
PLoS One 2012 7(5) e36584 
[ PubMed ID = 22590572 ] [ RRC reference ]

Geng X, Zhou QH, Kage-Nakadai E, Shi Y, Yan N, Mitani S, Xue D.
Caenorhabditis elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells.
Cell Death Differ 2009 16(10) 1385-94 
[ PubMed ID = 19575016 ] [ RRC reference ]