Allele Name | tm3077 |
Allele Type | 通常株 |
Sequence Name | Y73B6BL.7 |
Gene Name | csp-2 |
Worm Base | Allele Name |
tm3077
|
Gene Name |
csp-2
|
Sequence |
Y73B6BL.7
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 28927/28928-29244/29245 (317 bp deletion) |
Chromosome | IV |
Putative gene structure | join(21611..21668, 21717..21761, 23028..23173, 23521..23670, 23772..23958, 24486..25184, 25323..25400, 25454..25522, 25838..25948, 26210..26320, 28295..28545, 28591..28792, 28840..28934, 28979..29215, 29258..29299) |
Map position | 3.15 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:CACGTCATTTCTAGACGTCG,ExtRev:ATACTGATCACCGAGGCCAT,ExtFwd:GCCGGGCTATCATAATTAAC,IntFwd:ACGTTTGGGATATCAGTCGA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Jeong PY, Kumar A, Joshi PM, Rothman JH. Intertwined Functions of Separase and Caspase in Cell Division and Programmed Cell Death. Sci Rep 2020 10(1) 6159
[ PubMed ID = 32273538 ]
[ RRC reference ]
|
Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC. C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase. PLoS One 2012 7(5) e36584
[ PubMed ID = 22590572 ]
[ RRC reference ]
|
Wang H, Lu Q, Cheng S, Wang X, Zhang H. Autophagy activity contributes to programmed cell death in Caenorhabditis elegans. Autophagy 2013 9(12) 1975-82
[ PubMed ID = 24185352 ]
[ RRC reference ]
|
Geng X, Zhou QH, Kage-Nakadai E, Shi Y, Yan N, Mitani S, Xue D. Caenorhabditis elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells. Cell Death Differ 2009 16(10) 1385-94
[ PubMed ID = 19575016 ]
[ RRC reference ]
|
|