分離済み変異体

tm307

Allele Nametm307
BalanceNot Required
OutCrossNot Accepted
Sequence NameF40E10.4
Gene Nameslt-1
Worm BaseAllele Name tm307
Gene Name slt-1
Sequence F40E10.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Bargmann; Neuron 32, 25-38 (2001).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C26G2] 25435/25436-[C26G2] 26526/26527 (1091 bp deletion)
ChromosomeX
Putative gene structureCEC26G2 join(24672..24817, 24861..24932, 25380..25451, 25495..25566, 25619..25717, 25767..25874, 25943..26087, 26143..26303, 26775..26846, 26899..26970, 27021..27400, 27966..28062, 28112..28312,28359..28430,28486..28557, 28606..28754, 28804..29011, 29056..29152, 29762..29880, 29932..30087, Z69792.1:150..653, Z69792.1:1191..1284, Z69792.1:1332..1457, Z69792.1:1502..1680, Z69792.1:1727..1851, Z69792.1:1902..2120, Z69792.1:2675..2782, Z69792.1:2832..2933, Z69792.1:2983..3095, Z69792.1:3154..3336
Map position18.36
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTTGTGTTTCTCTCGCTAA,IntFwd:AGACGACTAACCAATGTGTG,IntRev:GTAGAGCACTCTGGAATACA,ExtRev:AAGTCCCTCGAAAGTATCCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hao JC, Yu TW, Fujisawa K, Culotti JG, Gengyo-Ando K, Mitani S, Moulder G, Barstead R, Tessier-Lavigne M, Bargmann CI.
C. elegans slit acts in midline, dorsal-ventral, and anterior-posterior guidance via the SAX-3/Robo receptor.
Neuron 2001 32(1) 25-38 
[ PubMed ID = 11604136 ] [ RRC reference ]