分離済み変異体

tm306

Allele Name

tm306

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F15B9.7

Gene Name

fmi-1

Worm Base

Allele Name

tm306

Gene Name

fmi-1

Sequence

F15B9.7

Phenotype

homozygous viable. Dr. A. Colavita: no defects in VC axon guidance or morphology. Dr. G. Garriga: HSN axon normal. Dr. H. Sawa: no Psa phenotype. Dr. M. Herman: minor B cell polarity defect.

Mutation site

[W07G4] 9426/9427-GA-[W07G4] 10248/10249 (822 bp deletion)

Chromosome

Putative gene structure

join(31209..31714, 32029..32173, Z78018.1:230..295, Z78018.1:481..615, Z78018.1:2665..3356, Z78018.1:3401..3506, Z78018.1:3575..4138, Z78018.1:4220..4433, Z78018.1:4839..4924, Z78018.1:5216..5370, Z78018.1:5652..5911, Z78018.1:5958..6483, Z78018.1:6530..6652, Z78018.1:7190..7431, Z78018.1:7480..7605, Z78018.1:8210..8435, Z78018.1:8487..8580, Z78018.1:8630..8740, Z78018.1:8822..8922, Z78018.1:9218..10080, Z78018.1:10138..10541, Z78018.1:10589..11153, Z78018.1:11201..11592, Z78018.1:11645..11958, Z78018.1:12262..12514, Z78018.1:12563..13126)

Map position

4.81

Balancer

Map position of balancer

Sequence of primers

IntRev:AAAAGTTCCCCACCATCCAG,IntFwd:GTTGCGTTCGAGAACACGTA,ExtFwd:CCATGGTGACTGTGATACGC,ExtRev:TTCTTGCACTGACATGCTCC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Peysson A, Zariohi N, Gendrel M, Chambert-Loir A, Frébault N, Cheynet E, Andrini O, Boulin T.
Wnt-Ror-Dvl signalling and the dystrophin complex organize planar-polarized membrane compartments in C. elegans muscles.
Nat Commun 2024 15(1) 4935
[ PubMed ID = 38858388 ] [ RRC reference ]

Schön JL, Groß VE, Post WB, Daum A, Matúš D, Pilz J, Schnorr R, Horn S, Bäumers M, Weidtkamp-Peters S, Hughes S, Schöneberg T, Prömel S.
The adhesion GPCR and PCP component flamingo (FMI-1) alters body size and regulates the composition of the extracellular matrix.
Matrix Biol 2024 128 1-10
[ PubMed ID = 38378098 ] [ RRC reference ]

Sakai N, Sun P, Kim B, Emmons SW.
Function of cell adhesion molecules in differentiation of ray sensory neurons in C. elegans.
G3 (Bethesda) 2023 13(3)
[ PubMed ID = 36573343 ] [ RRC reference ]

Lu M, Mizumoto K.
Gradient-independent Wnt signaling instructs asymmetric neurite pruning in C. elegans.
Elife 2019 8
[ PubMed ID = 31804181 ] [ RRC reference ]

Huarcaya Najarro E, Ackley BD.
C. elegans fmi-1/flamingo and Wnt pathway components interact genetically to control the anteroposterior neurite growth of the VD GABAergic neurons.
Dev Biol 2013 377(1) 224-35
[ PubMed ID = 23376536 ] [ RRC reference ]

Najarro EH, Wong L, Zhen M, Carpio EP, Goncharov A, Garriga G, Lundquist EA, Jin Y, Ackley BD.
Caenorhabditis elegans flamingo cadherin fmi-1 regulates GABAergic neuronal development.
J Neurosci 2012 32(12) 4196-211
[ PubMed ID = 22442082 ] [ RRC reference ]

Sanchez-Alvarez L, Visanuvimol J, McEwan A, Su A, Imai JH, Colavita A.
VANG-1 and PRKL-1 cooperate to negatively regulate neurite formation in Caenorhabditis elegans.
PLoS Genet 2011 7(9) e1002257
[ PubMed ID = 21912529 ] [ RRC reference ]

Langenhan T, Prömel S, Mestek L, Esmaeili B, Waller-Evans H, Hennig C, Kohara Y, Avery L, Vakonakis I, Schnabel R, Russ AP.
Latrophilin signaling links anterior-posterior tissue polarity and oriented cell divisions in the C. elegans embryo.
Dev Cell 2009 17(4) 494-504
[ PubMed ID = 19853563 ] [ RRC reference ]

Wu M, Herman MA.
A novel noncanonical Wnt pathway is involved in the regulation of the asymmetric B cell division in C. elegans.
Dev Biol 2006 293(2) 316-29
[ PubMed ID = 16631156 ] [ RRC reference ]