分離済み変異体

tm306

Allele Name

tm306

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F15B9.7

Gene Name

fmi-1

Worm Base

Allele Name

tm306

Gene Name

fmi-1

Sequence

F15B9.7

Phenotype

homozygous viable. Dr. A. Colavita: no defects in VC axon guidance or morphology. Dr. G. Garriga: HSN axon normal. Dr. H. Sawa: no Psa phenotype. Dr. M. Herman: minor B cell polarity defect.

Mutation site

[W07G4] 9426/9427-GA-[W07G4] 10248/10249 (822 bp deletion)

Chromosome

Putative gene structure

join(31209..31714, 32029..32173, Z78018.1:230..295, Z78018.1:481..615, Z78018.1:2665..3356, Z78018.1:3401..3506, Z78018.1:3575..4138, Z78018.1:4220..4433, Z78018.1:4839..4924, Z78018.1:5216..5370, Z78018.1:5652..5911, Z78018.1:5958..6483, Z78018.1:6530..6652, Z78018.1:7190..7431, Z78018.1:7480..7605, Z78018.1:8210..8435, Z78018.1:8487..8580, Z78018.1:8630..8740, Z78018.1:8822..8922, Z78018.1:9218..10080, Z78018.1:10138..10541, Z78018.1:10589..11153, Z78018.1:11201..11592, Z78018.1:11645..11958, Z78018.1:12262..12514, Z78018.1:12563..13126)

Map position

4.81

Balancer

Map position of balancer

Sequence of primers

IntRev:AAAAGTTCCCCACCATCCAG,IntFwd:GTTGCGTTCGAGAACACGTA,ExtFwd:CCATGGTGACTGTGATACGC,ExtRev:TTCTTGCACTGACATGCTCC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Hall AN, Morton EA, Walters R, Cuperus JT, Queitsch C.
Phenotypic tolerance for rDNA copy number variation within the natural range of C. elegans.
PLoS Genet 2025 21(7) e1011759
[ PubMed ID = 40601579 ] [ RRC reference ]

Peysson A, Zariohi N, Gendrel M, Chambert-Loir A, Frébault N, Cheynet E, Andrini O, Boulin T.
Wnt-Ror-Dvl signalling and the dystrophin complex organize planar-polarized membrane compartments in C. elegans muscles.
Nat Commun 2024 15(1) 4935
[ PubMed ID = 38858388 ] [ RRC reference ]

Schön JL, Groß VE, Post WB, Daum A, Matúš D, Pilz J, Schnorr R, Horn S, Bäumers M, Weidtkamp-Peters S, Hughes S, Schöneberg T, Prömel S.
The adhesion GPCR and PCP component flamingo (FMI-1) alters body size and regulates the composition of the extracellular matrix.
Matrix Biol 2024 128 1-10
[ PubMed ID = 38378098 ] [ RRC reference ]

Sakai N, Sun P, Kim B, Emmons SW.
Function of cell adhesion molecules in differentiation of ray sensory neurons in C. elegans.
G3 (Bethesda) 2023 13(3)
[ PubMed ID = 36573343 ] [ RRC reference ]

Lu M, Mizumoto K.
Gradient-independent Wnt signaling instructs asymmetric neurite pruning in C. elegans.
Elife 2019 8
[ PubMed ID = 31804181 ] [ RRC reference ]

Huarcaya Najarro E, Ackley BD.
C. elegans fmi-1/flamingo and Wnt pathway components interact genetically to control the anteroposterior neurite growth of the VD GABAergic neurons.
Dev Biol 2013 377(1) 224-35
[ PubMed ID = 23376536 ] [ RRC reference ]

Najarro EH, Wong L, Zhen M, Carpio EP, Goncharov A, Garriga G, Lundquist EA, Jin Y, Ackley BD.
Caenorhabditis elegans flamingo cadherin fmi-1 regulates GABAergic neuronal development.
J Neurosci 2012 32(12) 4196-211
[ PubMed ID = 22442082 ] [ RRC reference ]

Sanchez-Alvarez L, Visanuvimol J, McEwan A, Su A, Imai JH, Colavita A.
VANG-1 and PRKL-1 cooperate to negatively regulate neurite formation in Caenorhabditis elegans.
PLoS Genet 2011 7(9) e1002257
[ PubMed ID = 21912529 ] [ RRC reference ]

Langenhan T, Prömel S, Mestek L, Esmaeili B, Waller-Evans H, Hennig C, Kohara Y, Avery L, Vakonakis I, Schnabel R, Russ AP.
Latrophilin signaling links anterior-posterior tissue polarity and oriented cell divisions in the C. elegans embryo.
Dev Cell 2009 17(4) 494-504
[ PubMed ID = 19853563 ] [ RRC reference ]

Wu M, Herman MA.
A novel noncanonical Wnt pathway is involved in the regulation of the asymmetric B cell division in C. elegans.
Dev Biol 2006 293(2) 316-29
[ PubMed ID = 16631156 ] [ RRC reference ]