分離済み変異体

tm3056

Allele Name

tm3056

Allele Type

通常株

Sequence Name

Y54G2A.25

Gene Name

lad-2

Worm Base

Allele Name

tm3056

Gene Name

lad-2

Sequence

Y54G2A.25

Phenotype

homozygous viable. Dr. L. Chen: J. Cell Biol. 180, 233 (2008).

Mutation site

223647/223648-224711/224712 (1064 bp deletion)

Chromosome

Putative gene structure

complement(join(214208..214285, 215029..215279, 215955..216146, 216197..216352, 216563..216691, 216996..217107, 217364..217554, 217604..217727, 217772..218140, 218590..218723, 218771..218889, 218945..219104, 219519..219639, 223240..223400, 223454..223741, 224310..224594, 224645..224847, 226089..226209, 226993..227063, 227110..227226, 227951..228065, 228111..228177))

Map position

-6.72

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ATCCCAACGGATTGCTAGCA,IntFwd:GCTAGCATTGCATTGGTAGA,IntRev:AACTATCCGGAGCCGACACA,ExtRev:CCTAGACGATTCCTCCGTAA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Julien C, Lissouba A, Madabattula S, Fardghassemi Y, Rosenfelt C, Androschuk A, Strautman J, Wong C, Bysice A, O'sullivan J, Rouleau GA, Drapeau P, Parker JA, Bolduc FV.
Conserved pharmacological rescue of hereditary spastic paraplegia-related phenotypes across model organisms.
Hum Mol Genet 2016 25(6) 1088-99
[ PubMed ID = 26744324 ] [ RRC reference ]

Schwieterman AA, Steves AN, Yee V, Donelson CJ, Bentley MR, Santorella EM, Mehlenbacher TV, Pital A, Howard AM, Wilson MR, Ereddia DE, Effrein KS, McMurry JL, Ackley BD, Chisholm AD, Hudson ML.
The Caenorhabditis elegans Ephrin EFN-4 Functions Non-cell Autonomously with Heparan Sulfate Proteoglycans to Promote Axon Outgrowth and Branching.
Genetics 2016 202(2) 639-60
[ PubMed ID = 26645816 ] [ RRC reference ]

Dong B, Moseley-Alldredge M, Schwieterman AA, Donelson CJ, McMurry JL, Hudson ML, Chen L.
EFN-4 functions in LAD-2-mediated axon guidance in Caenorhabditis elegans.
Development 2016 143(7) 1182-91
[ PubMed ID = 26903502 ] [ RRC reference ]

Chen L, Zhou S.
"CRASH"ing with the worm: insights into L1CAM functions and mechanisms.
Dev Dyn 2010 239(5) 1490-501
[ PubMed ID = 20225255 ] [ RRC reference ]

Salzberg Y, Díaz-Balzac CA, Ramirez-Suarez NJ, Attreed M, Tecle E, Desbois M, Kaprielian Z, Bülow HE.
Skin-derived cues control arborization of sensory dendrites in Caenorhabditis elegans.
Cell 2013 155(2) 308-20
[ PubMed ID = 24120132 ] [ RRC reference ]

Wang X, Zhang W, Cheever T, Schwarz V, Opperman K, Hutter H, Koepp D, Chen L.
The C. elegans L1CAM homologue LAD-2 functions as a coreceptor in MAB-20/Sema2 mediated axon guidance.
J Cell Biol 2008 180(1) 233-46
[ PubMed ID = 18195110 ] [ RRC reference ]