分離済み変異体

tm3056

Allele Nametm3056
BalanceNot Required
OutCrossNot Accepted
Sequence NameY54G2A.25
Gene Namelad-2
Worm BaseAllele Name tm3056
Gene Name lad-2
Sequence Y54G2A.25
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. L. Chen: J. Cell Biol. 180, 233 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 223647/223648-224711/224712 (1064 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(214208..214285, 215029..215279, 215955..216146, 216197..216352, 216563..216691, 216996..217107, 217364..217554, 217604..217727, 217772..218140, 218590..218723, 218771..218889, 218945..219104, 219519..219639, 223240..223400, 223454..223741, 224310..224594, 224645..224847, 226089..226209, 226993..227063, 227110..227226, 227951..228065, 228111..228177))
Map position-6.72
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCCCAACGGATTGCTAGCA,IntFwd:GCTAGCATTGCATTGGTAGA,IntRev:AACTATCCGGAGCCGACACA,ExtRev:CCTAGACGATTCCTCCGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Buyannemekh K, Villoutreix P, Bertrand V.
Left/right asymmetrically expressed ephrin and Flamingo proteins regulate lateralized axon growth in C. elegans.
Dev Biol 2025 517 117-125 
[ PubMed ID = 39341445 ] [ RRC reference ]

Dong B, Moseley-Alldredge M, Schwieterman AA, Donelson CJ, McMurry JL, Hudson ML, Chen L.
EFN-4 functions in LAD-2-mediated axon guidance in Caenorhabditis elegans.
Development 2016 143(7) 1182-91 
[ PubMed ID = 26903502 ] [ RRC reference ]

Julien C, Lissouba A, Madabattula S, Fardghassemi Y, Rosenfelt C, Androschuk A, Strautman J, Wong C, Bysice A, O'sullivan J, Rouleau GA, Drapeau P, Parker JA, Bolduc FV.
Conserved pharmacological rescue of hereditary spastic paraplegia-related phenotypes across model organisms.
Hum Mol Genet 2016 25(6) 1088-99 
[ PubMed ID = 26744324 ] [ RRC reference ]

Schwieterman AA, Steves AN, Yee V, Donelson CJ, Bentley MR, Santorella EM, Mehlenbacher TV, Pital A, Howard AM, Wilson MR, Ereddia DE, Effrein KS, McMurry JL, Ackley BD, Chisholm AD, Hudson ML.
The Caenorhabditis elegans Ephrin EFN-4 Functions Non-cell Autonomously with Heparan Sulfate Proteoglycans to Promote Axon Outgrowth and Branching.
Genetics 2016 202(2) 639-60 
[ PubMed ID = 26645816 ] [ RRC reference ]

Salzberg Y, Díaz-Balzac CA, Ramirez-Suarez NJ, Attreed M, Tecle E, Desbois M, Kaprielian Z, Bülow HE.
Skin-derived cues control arborization of sensory dendrites in Caenorhabditis elegans.
Cell 2013 155(2) 308-20 
[ PubMed ID = 24120132 ] [ RRC reference ]

Chen L, Zhou S.
"CRASH"ing with the worm: insights into L1CAM functions and mechanisms.
Dev Dyn 2010 239(5) 1490-501 
[ PubMed ID = 20225255 ] [ RRC reference ]

Wang X, Zhang W, Cheever T, Schwarz V, Opperman K, Hutter H, Koepp D, Chen L.
The C. elegans L1CAM homologue LAD-2 functions as a coreceptor in MAB-20/Sema2 mediated axon guidance.
J Cell Biol 2008 180(1) 233-46 
[ PubMed ID = 18195110 ] [ RRC reference ]