Allele Name | tm3039 |
Allele Type | 通常株 |
Sequence Name | F07A11.3 |
Gene Name | npp-5 |
Worm Base | Allele Name |
tm3039
|
Gene Name |
npp-5
|
Sequence |
F07A11.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 13192/13193-A-13716/13717 (524 bp deletion + 1 bp insertion) |
Chromosome | II |
Putative gene structure | complement(join(10983..11279, 11336..11581, 11763..12211, 12258..13281, 13334..13540, 13589..13701, 13758..13863)) |
Map position | 3.78 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GGGGGACAATTCTTCCAACT,IntFwd:TCCAGAGCCGCGTGTTCGAT,ExtFwd:ACGAAAGAGCAGAGCCCATA,IntRev:CAACTCCTTCGACGACTCTA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Askjaer P, Galy V, Meister P. Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans. Methods Cell Biol 2014 122 277-310
[ PubMed ID = 24857735 ]
[ RRC reference ]
|
Lawrence KS, Chau T, Engebrecht J. DNA damage response and spindle assembly checkpoint function throughout the cell cycle to ensure genomic integrity. PLoS Genet 2015 11(4) e1005150
[ PubMed ID = 25898113 ]
[ RRC reference ]
|
Bohr T, Nelson CR, Klee E, Bhalla N. Spindle assembly checkpoint proteins regulate and monitor meiotic synapsis in C. elegans. J Cell Biol 2015 211(2) 233-42
[ PubMed ID = 26483555 ]
[ RRC reference ]
|
Ródenas E, González-Aguilera C, Ayuso C, Askjaer P. Dissection of the NUP107 nuclear pore subcomplex reveals a novel interaction with spindle assembly checkpoint protein MAD1 in Caenorhabditis elegans. Mol Biol Cell 2012 23(5) 930-44
[ PubMed ID = 22238360 ]
[ RRC reference ]
|
|