分離済み変異体

tm3036

Allele Nametm3036
BalanceNot Required
OutCrossNot Accepted
Sequence NameF13B10.1b
Gene Nametir-1
Worm BaseAllele Name tm3036
Gene Name tir-1
Sequence F13B10.1b
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Ewbank: Curr. Biol. 18, 481 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2308/2309-2577/2578 (269 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(1550..1635, 1693..1810, 1967..3001, 4342..4863))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AAGTTCGCCTCCGAAGCACT,ExtRev:AAGTGGCCTCCTCTCCAGAC,IntFwd:GCACCCAATCCTCACAGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Landschaft-Berliner D, Goldstein K, Teichman G, Anava S, Gingold H, Salzberg Y, Rieger I, Levy N, Pechuk V, Setty H, Agarwal P, Sagi D, Cohen D, Nikelshparg E, Ben-Zvi A, Miranda-Vizuete A, Zaidel-Bar R, Oren-Suissa M, Rechavi O.
Cold and lithium delay forgetting of olfactory memories in Caenorhabditis elegans.
Nat Neurosci 2026 29(2) 387-398 
[ PubMed ID = 41413661 ] [ RRC reference ]

Zhu M, Wang J, Zhu L, Zhu M.
Investigations of forgetting in Caenorhabditis elegans.
Neurobiol Learn Mem 2025 220 108061 
[ PubMed ID = 40350072 ] [ RRC reference ]

Peters L, Drechsler M, Herrera MA, Liu J, Pees B, Jarstorff J, Czerwinski A, Lubbock F, Angelidou G, Salzer L, Moors KA, Paczia N, Shi YM, Schulenburg H, Kaleta C, Witting M, Liebeke M, Campopiano DJ, Bode HB, Dierking K.
Polyketide synthase-derived sphingolipids mediate microbiota protection against a bacterial pathogen in C. elegans.
Nat Commun 2025 16(1) 5151 
[ PubMed ID = 40461452 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Huang T, Suzuki K, Kunitomo H, Tomioka M, Iino Y.
Multiple p38/JNK mitogen-activated protein kinase (MAPK) signaling pathways mediate salt chemotaxis learning in C. elegans.
G3 (Bethesda) 2023 13(9)  
[ PubMed ID = 37310929 ] [ RRC reference ]

Wang Q, Fu R, Li G, Xiong S, Zhu Y, Zhang H.
Hedgehog receptors exert immune-surveillance roles in the epidermis across species.
Cell Rep 2023 42(8) 112929 
[ PubMed ID = 37527037 ] [ RRC reference ]

Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716 
[ PubMed ID = 37349299 ] [ RRC reference ]

Czech VL, O'Connor LC, Philippon B, Norman E, Byrne AB.
TIR-1/SARM1 inhibits axon regeneration and promotes axon degeneration.
Elife 2023 12  
[ PubMed ID = 37083456 ] [ RRC reference ]

Zhang J, Zhao Y, Sun Z, Sun T.
Lacticaseibacillus rhamnosus Probio-M9 extends the lifespan of Caenorhabditis elegans.
Commun Biol 2022 5(1) 1139 
[ PubMed ID = 36302976 ] [ RRC reference ]

Arai M, Kurokawa I, Arakane H, Kitazono T, Ishihara T.
Regulation of Diacylglycerol Content in Olfactory Neurons Determines Forgetting or Retrieval of Olfactory Memory in Caenorhabditis elegans.
J Neurosci 2022 42(43) 8039-8053 
[ PubMed ID = 36104280 ] [ RRC reference ]

Teo JH, Kurokawa I, Onishi Y, Sato N, Kitazono T, Tokunaga T, Fujiwara M, Ishihara T.
Behavioral Forgetting of Olfactory Learning Is Mediated by Interneuron-Regulated Network Plasticity in Caenorhabditis elegans.
eNeuro 2022 9(4)  
[ PubMed ID = 35977825 ] [ RRC reference ]

Madhu B, Lakdawala MF, Issac NG, Gumienny TL.
Caenorhabditis elegans saposin-like spp-9 is involved in specific innate immune responses.
Genes Immun 2020 21(5) 301-310 
[ PubMed ID = 32770079 ] [ RRC reference ]

Kew C, Huang W, Fischer J, Ganesan R, Robinson N, Antebi A.
Evolutionarily conserved regulation of immunity by the splicing factor RNP-6/PUF60.
Elife 2020 9  
[ PubMed ID = 32538777 ] [ RRC reference ]

Flynn SM, Chen C, Artan M, Barratt S, Crisp A, Nelson GM, Peak-Chew SY, Begum F, Skehel M, de Bono M.
MALT-1 mediates IL-17 neural signaling to regulate C. elegans behavior, immunity and longevity.
Nat Commun 2020 11(1) 2099 
[ PubMed ID = 32350248 ] [ RRC reference ]

Alqadah A, Hsieh YW, Xiong R, Lesch BJ, Chang C, Chuang CF.
A universal transportin protein drives stochastic choice of olfactory neurons via specific nuclear import of a sox-2-activating factor.
Proc Natl Acad Sci U S A 2019 116(50) 25137-25146 
[ PubMed ID = 31767767 ] [ RRC reference ]

Verma S, Jagtap U, Goyala A, Mukhopadhyay A.
A novel gene-diet pair modulates C. elegans aging.
PLoS Genet 2018 14(8) e1007608 
[ PubMed ID = 30125273 ] [ RRC reference ]

Kitazono T, Hara-Kuge S, Matsuda O, Inoue A, Fujiwara M, Ishihara T.
Multiple Signaling Pathways Coordinately Regulate Forgetting of Olfactory Adaptation through Control of Sensory Responses in Caenorhabditis elegans.
J Neurosci 2017 37(42) 10240-10251 
[ PubMed ID = 28924007 ] [ RRC reference ]

Nichols ALA, Meelkop E, Linton C, Giordano-Santini R, Sullivan RK, Donato A, Nolan C, Hall DH, Xue D, Neumann B, Hilliard MA.
The Apoptotic Engulfment Machinery Regulates Axonal Degeneration in C. elegans Neurons.
Cell Rep 2016 14(7) 1673-1683 
[ PubMed ID = 26876181 ] [ RRC reference ]