分離済み変異体

tm301

Allele Nametm301
BalanceCompleted
OutCrossNot Accepted
Sequence NameF56C9.1
Gene Namegsp-2
Worm BaseAllele Name tm301 (x1)
Gene Name gsp-2
Sequence F56C9.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile: Dr. R. Hosono: Exp. Cell Res. 287, 350-360 (2003).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31014/31015-AATCATCAGTCGATTTATCT-31335/31336 (321 bp deletion + 20 bp insertion)
ChromosomeIII
Putative gene structurejoin(29773..29824, 29881..30012, 30139..30369, 30428..30642, 30692..30805, 30853..30987, 31217..31339)
Map position-0.73
BalancereT1
Map position of balancer
Sequence of primersExtFwd:GACAAAGGTGCATTGTTACC,IntFwd:CTAGACATGACATGGGGAGA,ExtRev:AACGAAGAGTACGGGATGGA,IntRev:GTGAGGAGTCATTAGCTCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sato-Carlton A, Nakamura-Tabuchi C, Li X, Boog H, Lehmer MK, Rosenberg SC, Barroso C, Martinez-Perez E, Corbett KD, Carlton PM.
Phosphoregulation of HORMA domain protein HIM-3 promotes asymmetric synaptonemal complex disassembly in meiotic prophase in Caenorhabditis elegans.
PLoS Genet 2020 16(11) e1008968 
[ PubMed ID = 33175901 ] [ RRC reference ]

Billmyre KK, Doebley AL, Spichal M, Heestand B, Belicard T, Sato-Carlton A, Flibotte S, Simon M, Gnazzo M, Skop A, Moerman D, Carlton PM, Sarkies P, Ahmed S.
The meiotic phosphatase GSP-2/PP1 promotes germline immortality and small RNA-mediated genome silencing.
PLoS Genet 2019 15(3) e1008004 
[ PubMed ID = 30921322 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Chartrand SK, Uchino T, Carlton PM.
Phosphorylation of the synaptonemal complex protein SYP-1 promotes meiotic chromosome segregation.
J Cell Biol 2018 217(2) 555-570 
[ PubMed ID = 29222184 ] [ RRC reference ]

Peel N, Iyer J, Naik A, Dougherty MP, Decker M, O'Connell KF.
Protein Phosphatase 1 Down Regulates ZYG-1 Levels to Limit Centriole Duplication.
PLoS Genet 2017 13(1) e1006543 
[ PubMed ID = 28103229 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Sasagawa Y, Higashitani A, Urano T, Ogura T, Yamanaka K.
CDC-48/p97 is required for proper meiotic chromosome segregation via controlling AIR-2/Aurora B kinase localization in Caenorhabditis elegans.
J Struct Biol 2012 179(2) 104-11 
[ PubMed ID = 22735043 ] [ RRC reference ]

de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]

Sassa T, Ueda-Ohba H, Kitamura K, Harada S, Hosono R.
Role of Caenorhabditis elegans protein phosphatase type 1, CeGLC-7 beta, in metaphase to anaphase transition during embryonic development.
Exp Cell Res 2003 287(2) 350-60 
[ PubMed ID = 12837290 ] [ RRC reference ]