分離済み変異体

tm2994

Allele Nametm2994
BalanceNot Required
OutCrossNot Accepted
Sequence NameF36H1.5
Gene NameF36H1.5
Worm BaseAllele Name tm2994
Gene Name F36H1.5
Sequence F36H1.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7179/7180-7381/7382 (202 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(7022..7185, 7231..7320, 7540..7909))
Map position4.79
Balancer
Map position of balancer
Sequence of primersIntRev:ATGAGTCATGACCCACGCAT,ExtRev:GAAAGCCGCATATTACCGGT,IntFwd:GCCAAGTCCATTTAGTGATC,ExtFwd:AGAGCTACTGTCTACCAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zeidan RS, Ebea-Ugwuanyi P, Sykes S, Evripidou N, Pan E, Markovich Z, Sheng Y, Han SM, Leeuwenburgh C, Xiao R.
Exploring age-related iron dysregulation: effects on longevity, body size, and behavior in C. elegans.
Exp Gerontol 2025 208 112826 
[ PubMed ID = 40617521 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]

Yuan X, Protchenko O, Philpott CC, Hamza I.
Topologically conserved residues direct heme transport in HRG-1-related proteins.
J Biol Chem 2012 287(7) 4914-24 
[ PubMed ID = 22174408 ] [ RRC reference ]