分離済み変異体

tm299

Allele Nametm299
BalanceCompleted
OutCrossNot Accepted
Sequence NameT15H9.3
Gene Namehlh-6
Worm BaseAllele Name tm299 (x1)
Gene Name hlh-6
Sequence T15H9.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. J. Gaudet: PLoS Genetics 4, e1000222 (2008)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11224/11225-11819/11820 (595 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(10595..10787, 11095..11193, 11238..11541, 11683..11893))
Map position1.51
Balancer,mIn1 [e128 mIs14]
Map position of balancer
Sequence of primersIntRev:GGCGCGAAGTTTTATGCCAA,ExtFwd:AGAAACGAGTGCTCGTGGAA,IntFwd:CCAAGACCCCAGTCAATTCA,ExtRev:ATATACATATTGGCCAGGCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]

Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet 2016 12(8) e1006237 
[ PubMed ID = 27487365 ] [ RRC reference ]

Ghai V, Smit RB, Gaudet J.
Transcriptional regulation of HLH-6-independent and subtype-specific genes expressed in the Caenorhabditis elegans pharyngeal glands.
Mech Dev 2012 129(9-12) 284-97 
[ PubMed ID = 22759833 ] [ RRC reference ]

Raharjo WH, Ghai V, Dineen A, Bastiani M, Gaudet J.
Cell architecture: surrounding muscle cells shape gland cell morphology in the Caenorhabditis elegans pharynx.
Genetics 2011 189(3) 885-97 
[ PubMed ID = 21868609 ] [ RRC reference ]

Reece-Hoyes JS, Deplancke B, Barrasa MI, Hatzold J, Smit RB, Arda HE, Pope PA, Gaudet J, Conradt B, Walhout AJ.
The C. elegans Snail homolog CES-1 can activate gene expression in vivo and share targets with bHLH transcription factors.
Nucleic Acids Res 2009 37(11) 3689-98 
[ PubMed ID = 19372275 ] [ RRC reference ]

Smit RB, Schnabel R, Gaudet J.
The HLH-6 transcription factor regulates C. elegans pharyngeal gland development and function.
PLoS Genet 2008 4(10) e1000222 
[ PubMed ID = 18927627 ] [ RRC reference ]

Raharjo I, Gaudet J.
Gland-specific expression of C. elegans hlh-6 requires the combinatorial action of three distinct promoter elements.
Dev Biol 2007 302(1) 295-308 
[ PubMed ID = 17049341 ] [ RRC reference ]