分離済み変異体

tm2988

Allele Name

tm2988

Balance

Not Required

OutCross

Not Accepted

Sequence Name

W09C5.4

Gene Name

ins-33

Worm Base

Allele Name

tm2988

Gene Name

ins-33

Sequence

W09C5.4

Phenotype

homozygous viable. Dr. J. Kaplan: weak Hic. Dr. T. Katada: normal germline proliferation during L1 diapause.

Mutation site

10824/10825-11019/11020 (195 bp deletion)

Chromosome

Putative gene structure

complement(join(9848..9930, 10877..11168))

Map position

21.61

Balancer

Map position of balancer

Sequence of primers

ExtRev:GCCGTATATCTCGGCGGAGA,IntFwd:TAACTCTGCGGGGAGGCAAG,IntRev:CAGCAGCACTTTCACCGTAA,ExtFwd:CTATCTCTCCTCCCCACCGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5
[ PubMed ID = 31676170 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat Cell Biol 2017 19(3) 252-257
[ PubMed ID = 28166192 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr Biol 2015 25(9) 1241-8
[ PubMed ID = 25891400 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26
[ PubMed ID = 25128585 ] [ RRC reference ]

Chen X, Chalfie M.
Modulation of C. elegans touch sensitivity is integrated at multiple levels.
J Neurosci 2014 34(19) 6522-36
[ PubMed ID = 24806678 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]

Michaelson D, Korta DZ, Capua Y, Hubbard EJ.
Insulin signaling promotes germline proliferation in C. elegans.
Development 2010 137(4) 671-80
[ PubMed ID = 20110332 ] [ RRC reference ]