分離済み変異体

tm2984

Allele Nametm2984
BalanceNot Required
OutCrossNot Accepted
Sequence NameF18E9.2
Gene Namenlp-7
Worm BaseAllele Name tm2984
Gene Name nlp-7
Sequence F18E9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Iino: normal chemotaxis to NaCl, normal salt chemotaxis learning. Dr. J. Kaplan: slight increase in Nile Red staining. Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response. Dr. I. Mori: thermotaxis assay impossible, Unc.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29274/29275-31032/31033 (1758 bp deletion)
ChromosomeX
Putative gene structurejoin(29870..29937, 30086..30118, 30169..30288, 30342..30486)
Map position0.15
Balancer
Map position of balancer
Sequence of primersIntFwd:GATCAAAGGAACGGGCCCAA,ExtRev:CGCAGGAGGTTTTCTGGGCA,ExtFwd:GCGAACTCGGTTATTAGTGA,IntRev:ACGAATATAGTTGCTCCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Subramanian S, Diya N, Nelson MD.
Egg laying during stress-induced sleep of Caenorhabditis elegans is reduced due to behavioral quiescence and fertility defects.
MicroPubl Biol 2025 2025  
[ PubMed ID = 40741294 ] [ RRC reference ]

Staum M, Abraham AC, Arbid R, Birari VS, Dominitz M, Rabinowitch I.
Behavioral adjustment of C. elegans to mechanosensory loss requires intact mechanosensory neurons.
PLoS Biol 2024 22(7) e3002729 
[ PubMed ID = 39024405 ] [ RRC reference ]

Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S.
A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(21) e2406565121 
[ PubMed ID = 38753507 ] [ RRC reference ]

Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S.
Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34477553 ] [ RRC reference ]

Harris G, Wu T, Linfield G, Choi MK, Liu H, Zhang Y.
Molecular and cellular modulators for multisensory integration in C. elegans.
PLoS Genet 2019 15(3) e1007706 
[ PubMed ID = 30849079 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr Biol 2017 27(17) 2630-2639.e6 
[ PubMed ID = 28823678 ] [ RRC reference ]

Banerjee N, Bhattacharya R, Gorczyca M, Collins KM, Francis MM.
Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior.
PLoS Genet 2017 13(4) e1006697 
[ PubMed ID = 28384151 ] [ RRC reference ]

Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell 2016 39(2) 209-223 
[ PubMed ID = 27720609 ] [ RRC reference ]

Castelein N, Cai H, Rasulova M, Braeckman BP.
Lifespan regulation under axenic dietary restriction: a close look at the usual suspects.
Exp Gerontol 2014 58 96-103 
[ PubMed ID = 25066271 ] [ RRC reference ]

Harris G, Shen Y, Ha H, Donato A, Wallis S, Zhang X, Zhang Y.
Dissecting the signaling mechanisms underlying recognition and preference of food odors.
J Neurosci 2014 34(28) 9389-403 
[ PubMed ID = 25009271 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]

Mendenhall AR, Wu D, Park SK, Cypser JR, Tedesco PM, Link CD, Phillips PC, Johnson TE.
Genetic dissection of late-life fertility in Caenorhabditis elegans.
J Gerontol A Biol Sci Med Sci 2011 66(8) 842-54 
[ PubMed ID = 21622982 ] [ RRC reference ]

Park SK, Link CD, Johnson TE.
Life-span extension by dietary restriction is mediated by NLP-7 signaling and coelomocyte endocytosis in C. elegans.
FASEB J 2010 24(2) 383-92 
[ PubMed ID = 19783783 ] [ RRC reference ]

Takayama J, Faumont S, Kunitomo H, Lockery SR, Iino Y.
Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans.
Nucleic Acids Res 2010 38(1) 131-42 
[ PubMed ID = 19875417 ] [ RRC reference ]