Home > 分離済み変異体 > tm2984

分離済み変異体

Allele Name		tm2984
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F18E9.2
Gene Name		nlp-7
Worm Base	Allele Name	tm2984
	Gene Name	nlp-7
	Sequence	F18E9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. Y. Iino: normal chemotaxis to NaCl, normal salt chemotaxis learning. Dr. J. Kaplan: slight increase in Nile Red staining. Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response. Dr. I. Mori: thermotaxis assay impossible, Unc.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		29274/29275-31032/31033 (1758 bp deletion)
Chromosome		X
Putative gene structure		join(29870..29937, 30086..30118, 30169..30288, 30342..30486)
Map position		0.15
Balancer
Map position of balancer
Sequence of primers		IntFwd:GATCAAAGGAACGGGCCCAA,ExtRev:CGCAGGAGGTTTTCTGGGCA,ExtFwd:GCGAACTCGGTTATTAGTGA,IntRev:ACGAATATAGTTGCTCCCGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Staum M, Abraham AC, Arbid R, Birari VS, Dominitz M, Rabinowitch I. Behavioral adjustment of C. elegans to mechanosensory loss requires intact mechanosensory neurons. PLoS Biol 2024 22(7) e3002729  [ PubMed ID = 39024405 ] [ RRC reference ] Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S. A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2024 121(21) e2406565121  [ PubMed ID = 38753507 ] [ RRC reference ] Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S. Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans. Elife 2021 10   [ PubMed ID = 34477553 ] [ RRC reference ] Harris G, Wu T, Linfield G, Choi MK, Liu H, Zhang Y. Molecular and cellular modulators for multisensory integration in C. elegans. PLoS Genet 2019 15(3) e1007706  [ PubMed ID = 30849079 ] [ RRC reference ] Guillermin ML, Carrillo MA, Hallem EA. A Single Set of Interneurons Drives Opposite Behaviors in C. elegans. Curr Biol 2017 27(17) 2630-2639.e6  [ PubMed ID = 28823678 ] [ RRC reference ] Banerjee N, Bhattacharya R, Gorczyca M, Collins KM, Francis MM. Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior. PLoS Genet 2017 13(4) e1006697  [ PubMed ID = 28384151 ] [ RRC reference ] Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL. A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling. Dev Cell 2016 39(2) 209-223  [ PubMed ID = 27720609 ] [ RRC reference ] Castelein N, Cai H, Rasulova M, Braeckman BP. Lifespan regulation under axenic dietary restriction: a close look at the usual suspects. Exp Gerontol 2014 58 96-103  [ PubMed ID = 25066271 ] [ RRC reference ] Harris G, Shen Y, Ha H, Donato A, Wallis S, Zhang X, Zhang Y. Dissecting the signaling mechanisms underlying recognition and preference of food odors. J Neurosci 2014 34(28) 9389-403  [ PubMed ID = 25009271 ] [ RRC reference ] Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R. Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans. J Neurosci 2013 33(35) 14107-16  [ PubMed ID = 23986246 ] [ RRC reference ] Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y. Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans. PLoS Genet 2013 9(5) e1003472  [ PubMed ID = 23658528 ] [ RRC reference ] Mendenhall AR, Wu D, Park SK, Cypser JR, Tedesco PM, Link CD, Phillips PC, Johnson TE. Genetic dissection of late-life fertility in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 2011 66(8) 842-54  [ PubMed ID = 21622982 ] [ RRC reference ] Park SK, Link CD, Johnson TE. Life-span extension by dietary restriction is mediated by NLP-7 signaling and coelomocyte endocytosis in C. elegans. FASEB J 2010 24(2) 383-92  [ PubMed ID = 19783783 ] [ RRC reference ] Takayama J, Faumont S, Kunitomo H, Lockery SR, Iino Y. Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans. Nucleic Acids Res 2010 38(1) 131-42  [ PubMed ID = 19875417 ] [ RRC reference ]