分離済み変異体

tm2955

Allele Nametm2955
BalanceNot Required
OutCrossNot Accepted
Sequence NameF11C1.2
Gene NameF11C1.2
Worm BaseAllele Name tm2955
Gene Name F11C1.2
Sequence F11C1.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9316/9317-9529/9530 (213 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(8545..8672, 8990..9065, 9112..9195, 9345..9464, 9610..9678))
Map position9.25
Balancer
Map position of balancer
Sequence of primersExtRev:CTATCCGTAACACACGGGTT,IntRev:TGCAAGTACCGGACCACCTG,ExtFwd:AGCTTATCGTCGGAGGTATG,IntFwd:TCGTCGGAGGTATGAGTATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Traa A, Tamez González AA, Van Raamsdonk JM.
Developmental disruption of the mitochondrial fission gene drp-1 extends the longevity of daf-2 insulin/IGF-1 receptor mutant.
Geroscience 2025 47(1) 877-902 
[ PubMed ID = 39028454 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492 
[ PubMed ID = 32385951 ] [ RRC reference ]

Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]

Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM.
Mutations in Fis1 disrupt orderly disposal of defective mitochondria.
Mol Biol Cell 2014 25(1) 145-59 
[ PubMed ID = 24196833 ] [ RRC reference ]