分離済み変異体

tm295

Allele Nametm295
BalanceCompleted
OutCrossNot Accepted
Sequence NameC18A3.8
Gene Namehlh-14
Worm BaseAllele Name tm295 (x1)
Gene Name hlh-14
Sequence C18A3.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. G. Garriga another allele (tm276) missing PHB neurons.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36733/36734-37485/37486 (752 bp deletion)
ChromosomeII
Putative gene structurecomplement(join (36510..36751, 37073..37220, 37319..37642))
Map position-1.11
BalancermIn1
Map position of balancer
Sequence of primersIntFwd:GCTGACCCTATTTATTCGGA,ExtFwd:GCTGTCGGGAAAAGGTTTCC,IntRev:CATATGTGCTCGTACAAGCA,ExtRev:GAGCATTTATAAGTCAGGGC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mullan TW, Felton T, Tam J, Kasem O, Yeung TJ, Memar N, Schnabel R, Poole RJ.
Control of successive unequal cell divisions by neural cell fate regulators determines embryonic neuroblast cell size.
Development 2024 151(3)  
[ PubMed ID = 38205939 ] [ RRC reference ]

Masoudi N, Yemini E, Schnabel R, Hobert O.
Piecemeal regulation of convergent neuronal lineages by bHLH transcription factors in Caenorhabditis elegans.
Development 2021 148(11)  
[ PubMed ID = 34100067 ] [ RRC reference ]

Poole RJ, Bashllari E, Cochella L, Flowers EB, Hobert O.
A Genome-Wide RNAi Screen for Factors Involved in Neuronal Specification in Caenorhabditis elegans.
PLoS Genet 2011 7(6) e1002109 
[ PubMed ID = 21698137 ] [ RRC reference ]