分離済み変異体

tm2940

Allele Name

tm2940

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T12A2.8

Gene Name

T12A2.8

Worm Base

Allele Name

tm2940

Gene Name

T12A2.8

Sequence

T12A2.8

Phenotype

homozygous viable. Dr. S. Boulton: not Him.

Mutation site

29961/29962-TTTGTCGAAANCAACAT-30485/30486 (524 bp deletion + 17 bp insertion)

Chromosome

III

Putative gene structure

complement(join(28947..28998, 29158..29360, 29408..29591, 29641..29754, 29806..29971, 30026..30260, 30311..30400, 30455..30536, 30592..30682, 30729..30816))

Map position

-1.41

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GGCTTGAAGGCACTGCAATA,IntFwd:TCGCTTTCTGTCTGGAACCT,ExtRev:AACGGTGTGTAGTCGTGGCA,IntRev:GTCCCTCGTCGTCTCTCATG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Rieckher M, Gallrein C, Alquezar-Artieda N, Bourached-Silva N, Vaddavalli PL, Mares D, Backhaus M, Blindauer T, Greger K, Wiesner E, Pontel LB, Schumacher B.
Distinct DNA repair mechanisms prevent formaldehyde toxicity during development, reproduction and aging.
Nucleic Acids Res 2024 52(14) 8271-8285
[ PubMed ID = 38894680 ] [ RRC reference ]

Spatola BN, Lo JY, Wang B, Curran SP.
Nuclear and cytoplasmic WDR-23 isoforms mediate differential effects on GEN-1 and SKN-1 substrates.
Sci Rep 2019 9(1) 11783
[ PubMed ID = 31409866 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885
[ PubMed ID = 29046436 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480
[ PubMed ID = 28934497 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864
[ PubMed ID = 28634159 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002
[ PubMed ID = 27669035 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet 2013 9(7) e1003582
[ PubMed ID = 23874209 ] [ RRC reference ]

Craig AL, Moser SC, Bailly AP, Gartner A.
Methods for studying the DNA damage response in the Caenorhabdatis elegans germ line.
Methods Cell Biol 2012 107 321-52
[ PubMed ID = 22226529 ] [ RRC reference ]

Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet 2010 6(7) e1001025
[ PubMed ID = 20661466 ] [ RRC reference ]