| Allele Name | tm2927 |
| Allele Type | 通常株 |
| Sequence Name | C44C8.6a |
| Gene Name | mak-2 |
| Worm Base | Allele Name |
tm2927
|
| Gene Name |
mak-2
|
| Sequence |
C44C8.6a
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 7942/7943-8532/8533 (590 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(5151..5184, 5588..5663, 6684..6855, 7531..7910, 8315..8503, 8555..8679, 8800..9086, 10068..10136) |
| Map position | -23.03 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CCTTACCGGACTAGCTCCAC,IntFwd:GGAATGTGAGCACCGCCAGT,ExtRev:CCTAACTCCCTTACCGGACT,ExtFwd:ACAGGTTCTCGGCGTAGGAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Malinow RA, Zhu M, Jin Y, Kim KW.
Forward genetic screening identifies novel roles for N-terminal acetyltransferase C and histone deacetylase in C. elegans development.
Sci Rep 2022 12(1) 16438
[ PubMed ID = 36180459 ]
[ RRC reference ]
|
Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704
[ PubMed ID = 32986702 ]
[ RRC reference ]
|
Yan D, Wu Z, Chisholm AD, Jin Y.
The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration.
Cell 2009 138(5) 1005-18
[ PubMed ID = 19737525 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.