分離済み変異体

tm2927

Allele Nametm2927
BalanceNot Required
OutCrossNot Accepted
Sequence NameC44C8.6a
Gene Namemak-2
Worm BaseAllele Name tm2927
Gene Name mak-2
Sequence C44C8.6a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7942/7943-8532/8533 (590 bp deletion)
ChromosomeIV
Putative gene structurejoin(5151..5184, 5588..5663, 6684..6855, 7531..7910, 8315..8503, 8555..8679, 8800..9086, 10068..10136)
Map position-23.03
Balancer
Map position of balancer
Sequence of primersIntRev:CCTTACCGGACTAGCTCCAC,IntFwd:GGAATGTGAGCACCGCCAGT,ExtRev:CCTAACTCCCTTACCGGACT,ExtFwd:ACAGGTTCTCGGCGTAGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Malinow RA, Zhu M, Jin Y, Kim KW.
Forward genetic screening identifies novel roles for N-terminal acetyltransferase C and histone deacetylase in C. elegans development.
Sci Rep 2022 12(1) 16438 
[ PubMed ID = 36180459 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704 
[ PubMed ID = 32986702 ] [ RRC reference ]

Yan D, Wu Z, Chisholm AD, Jin Y.
The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration.
Cell 2009 138(5) 1005-18 
[ PubMed ID = 19737525 ] [ RRC reference ]