分離済み変異体

tm2923

Allele Nametm2923
BalanceNot Required
OutCrossNot Accepted
Sequence NameY46G5A.13
Gene NameY46G5A.13
Worm BaseAllele Name tm2923
Gene Name Y46G5A.13
Sequence Y46G5A.13
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 88054/88055-88388/88389 (334 bp deletion)
ChromosomeII
Putative gene structurejoin(88028..88152, 88214..88310, 88358..88453, 88543..88720, 89568..89873, 91063..91247, 92191..92508)
Map position11.21
Balancer
Map position of balancer
Sequence of primersExtRev:ACCGCGAATAATTTTCGCCT,IntRev:CGCCTCAGAAACTTCTCCGA,ExtFwd:CGCTCCACCGGACAACTGAT,IntFwd:CTTCGTTCTACACGGGAGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Andrusiak MG, Sharifnia P, Lyu X, Wang Z, Dickey AM, Wu Z, Chisholm AD, Jin Y.
Inhibition of Axon Regeneration by Liquid-like TIAR-2 Granules.
Neuron 2019 104(2) 290-304.e8 
[ PubMed ID = 31378567 ] [ RRC reference ]

Huelgas-Morales G, Silva-García CG, Salinas LS, Greenstein D, Navarro RE.
The Stress Granule RNA-Binding Protein TIAR-1 Protects Female Germ Cells from Heat Shock in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(4) 1031-47 
[ PubMed ID = 26865701 ] [ RRC reference ]

Rousakis A, Vlanti A, Borbolis F, Roumelioti F, Kapetanou M, Syntichaki P.
Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans.
PLoS One 2014 9(7) e103365 
[ PubMed ID = 25061667 ] [ RRC reference ]

Silva-García CG, Estela Navarro R.
The C. elegans TIA-1/TIAR homolog TIAR-1 is required to induce germ cell apoptosis.
Genesis 2013 51(10) 690-707 
[ PubMed ID = 23913578 ] [ RRC reference ]