分離済み変異体

tm2913

Allele Nametm2913
BalanceNot Required
OutCrossNot Accepted
Sequence NameY113G7A.5
Gene NameY113G7A.5
Worm BaseAllele Name tm2913
Gene Name Y113G7A.5
Sequence Y113G7A.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2603/2604-2900/2901 (297 bp deletion)
ChromosomeV
Putative gene structurejoin(AL117207.1:119131..119188, 417..527, 809..908, 2579..2756, 2833..3111, 3976..4107, 5132..5332, 6441..6553, 6684..6777, 7459..7623, 8794..8894, 10051..10135)
Map position24.36
Balancer
Map position of balancer
Sequence of primersIntRev:ATCAGGGGTGCTGAATCCAA,ExtRev:CTAGACTATATCAGGGGTGC,IntFwd:ATGGATAGCAGTGGCGCAGT,ExtFwd:CCTTTTTTCCCGCACCTTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yang JB, Chen RT, Chen YY, Lin YH, Chen CH.
Insulin and epidermal signals independently shape sexually dimorphic neurite branching in C. elegans.
EMBO Rep 2025 26(23) 5859-5876 
[ PubMed ID = 41174260 ] [ RRC reference ]

Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215 
[ PubMed ID = 40224011 ] [ RRC reference ]

Kramer TS, Wan FK, Pugliese SM, Atanas AA, Hiser AW, Luo J, Bueno E, Flavell SW.
Neural Sequences Underlying Directed Turning in C. elegans.
bioRxiv 2024   
[ PubMed ID = 39149398 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

De Rosa MJ, Veuthey T, Florman J, Grant J, Blanco MG, Andersen N, Donnelly J, Rayes D, Alkema MJ.
The flight response impairs cytoprotective mechanisms by activating the insulin pathway.
Nature 2019 573(7772) 135-138 
[ PubMed ID = 31462774 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Fu J, Zhang H, Huang W, Zhu X, Sheng Y, Song E, Xu T.
AIM interneurons mediate feeding suppression through the TYRA-2 receptor in C. elegans.
Biophys Rep 2018 4(1) 17-24 
[ PubMed ID = 29577066 ] [ RRC reference ]

Collins KM, Bode A, Fernandez RW, Tanis JE, Brewer JC, Creamer MS, Koelle MR.
Activity of the C. elegans egg-laying behavior circuit is controlled by competing activation and feedback inhibition.
Elife 2016 5  
[ PubMed ID = 27849154 ] [ RRC reference ]

Nagy S, Huang YC, Alkema MJ, Biron D.
Caenorhabditis elegans exhibit a coupling between the defecation motor program and directed locomotion.
Sci Rep 2015 5 17174 
[ PubMed ID = 26597056 ] [ RRC reference ]

Law W, Wuescher LM, Ortega A, Hapiak VM, Komuniecki PR, Komuniecki R.
Heterologous Expression in Remodeled C. elegans: A Platform for Monoaminergic Agonist Identification and Anthelmintic Screening.
PLoS Pathog 2015 11(4) e1004794 
[ PubMed ID = 25928899 ] [ RRC reference ]

Pirri JK, Rayes D, Alkema MJ.
A Change in the Ion Selectivity of Ligand-Gated Ion Channels Provides a Mechanism to Switch Behavior.
PLoS Biol 2015 13(9) e1002238 
[ PubMed ID = 26348462 ] [ RRC reference ]

Safratowich BD, Hossain M, Bianchi L, Carvelli L.
Amphetamine potentiates the effects of β-phenylethylamine through activation of an amine-gated chloride channel.
J Neurosci 2014 34(13) 4686-91 
[ PubMed ID = 24672014 ] [ RRC reference ]

Donnelly JL, Clark CM, Leifer AM, Pirri JK, Haburcak M, Francis MM, Samuel AD, Alkema MJ.
Monoaminergic orchestration of motor programs in a complex C. elegans behavior.
PLoS Biol 2013 11(4) e1001529 
[ PubMed ID = 23565061 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Maguire SM, Clark CM, Nunnari J, Pirri JK, Alkema MJ.
The C. elegans touch response facilitates escape from predacious fungi.
Curr Biol 2011 21(15) 1326-30 
[ PubMed ID = 21802299 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Pirri JK, McPherson AD, Donnelly JL, Francis MM, Alkema MJ.
A tyramine-gated chloride channel coordinates distinct motor programs of a Caenorhabditis elegans escape response.
Neuron 2009 62(4) 526-38 
[ PubMed ID = 19477154 ] [ RRC reference ]