分離済み変異体

tm2908

Allele Nametm2908
BalanceNot Required
OutCrossNot Accepted
Sequence NameF42G9.6a
Gene NameF42G9.6
Worm BaseAllele Name tm2908
Gene Name F42G9.6
Sequence F42G9.6a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26803/26804-AAAG-27008/27009 (205 bp deletion + 4 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(22868..23238, 23773..24149, 24692..25044, 25810..25973, 26463..26706, 26764..26945, 27010..27153, 27198..27313, 27387..27481))
Map position-26.08
Balancer
Map position of balancer
Sequence of primersIntRev:ATGCGATGCCCTCGCTAGTC,ExtRev:TCCAGGCAATGCGATGCCCT,IntFwd:GGGGAATGATATGCGAGTAG,ExtFwd:CCTTGACAGGCGGATACTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Perez-Gomez A, Carretero M, Weber N, Peterka V, To A, Titova V, Solis G, Osborn O, Petrascheck M.
A phenotypic Caenorhabditis elegans screen identifies a selective suppressor of antipsychotic-induced hyperphagia.
Nat Commun 2018 9(1) 5272 
[ PubMed ID = 30532051 ] [ RRC reference ]

Lin YH, Chen YC, Kao TY, Lin YC, Hsu TE, Wu YC, Ja WW, Brummel TJ, Kapahi P, Yuh CH, Yu LK, Lin ZH, You RJ, Jhong YT, Wang HD.
Diacylglycerol lipase regulates lifespan and oxidative stress response by inversely modulating TOR signaling in Drosophila and C. elegans.
Aging Cell 2014 13(4) 755-64 
[ PubMed ID = 24889782 ] [ RRC reference ]

Liu H, Wang X, Wang HD, Wu J, Ren J, Meng L, Wu Q, Dong H, Wu J, Kao TY, Ge Q, Wu ZX, Yuh CH, Shan G.
Escherichia coli noncoding RNAs can affect gene expression and physiology of Caenorhabditis elegans.
Nat Commun 2012 3 1073 
[ PubMed ID = 23011127 ] [ RRC reference ]