分離済み変異体

tm290

Allele Nametm290
BalanceCompleted
OutCrossNot Accepted
Sequence NameZK783.1
Gene Namefbn-1
Worm BaseAllele Name tm290 (x1)
Gene Name fbn-1
Sequence ZK783.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. K. Nishiwaki: normal DTC migration. Dr. A. Frand: Mlt.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3846/3847-4450/4451 (604 bp deletion)
ChromosomeIII
Putative gene structurejoin(137..176, 386..488, 970..1076, 1127..1464, 1760..2078, 2263..2496, 2546..3160, 3279..3335, 3467..5178, 5228..5321, 5397..6003, 6064..6185, 6383..7312, 7365..7778, 7828..8592, 8992..10416, 10489..10647, 10777..11430, 11530..11670, 11974..12401, 12450..12735, 12788..13084, 13153..13343, 13394..13450, 13502..13858, 13981..14038, 14476..14489)
Map position-0.63
BalancerhT2,hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:CGGAGCAGACTTCACAACAA,IntFwd:TCCGGATCGATTCAAACTTC,IntRev:TGATTCTCCAGATCCTTCCG,ExtRev:ACGGTAGCTGGCTCAACAGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Katz SS, Barker TJ, Maul-Newby HM, Sparacio AP, Nguyen KCQ, Maybrun CL, Belfi A, Cohen JD, Hall DH, Sundaram MV, Frand AR.
A transient apical extracellular matrix relays cytoskeletal patterns to shape permanent acellular ridges on the surface of adult C. elegans.
PLoS Genet 2022 18(8) e1010348 
[ PubMed ID = 35960773 ] [ RRC reference ]

Cohen JD, Sparacio AP, Belfi AC, Forman-Rubinsky R, Hall DH, Maul-Newby H, Frand AR, Sundaram MV.
A multi-layered and dynamic apical extracellular matrix shapes the vulva lumen in Caenorhabditis elegans.
Elife 2020 9  
[ PubMed ID = 32975517 ] [ RRC reference ]

Lažetić V, Joseph BB, Bernazzani SM, Fay DS.
Actin organization and endocytic trafficking are controlled by a network linking NIMA-related kinases to the CDC-42-SID-3/ACK1 pathway.
PLoS Genet 2018 14(4) e1007313 
[ PubMed ID = 29608564 ] [ RRC reference ]

Vuong-Brender TTK, Suman SK, Labouesse M.
The apical ECM preserves embryonic integrity and distributes mechanical stress during morphogenesis.
Development 2017 144(23) 4336-4349 
[ PubMed ID = 28526752 ] [ RRC reference ]

Kelley M, Yochem J, Krieg M, Calixto A, Heiman MG, Kuzmanov A, Meli V, Chalfie M, Goodman MB, Shaham S, Frand A, Fay DS.
FBN-1, a fibrillin-related protein, is required for resistance of the epidermis to mechanical deformation during C. elegans embryogenesis.
Elife 2015 4  
[ PubMed ID = 25798732 ] [ RRC reference ]

Yochem J, Lažetić V, Bell L, Chen L, Fay D.
C. elegans NIMA-related kinases NEKL-2 and NEKL-3 are required for the completion of molting.
Dev Biol 2015 398(2) 255-66 
[ PubMed ID = 25523392 ] [ RRC reference ]