Allele Name | tm2886 |
Allele Type | 通常株 |
Sequence Name | R06F6.5 |
Gene Name | npp-19 |
Worm Base | Allele Name |
tm2886
|
Gene Name |
npp-19
|
Sequence |
R06F6.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12165/12166-12425/12426 (260 bp deletion) |
Chromosome | II |
Putative gene structure | complement(join(11656..11727, 11780..11846, 12026..12210, 12261..12652, 12703..12975, 13025..13098, 13165..13238)) |
Map position | 2.98 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:TGATCGGCCATATCGTTCTC,IntFwd:CATGGAAGCAGATCGGTTTG,ExtRev:CAGGCCATGTTCTCGCATCT,IntRev:CATCCGGAAGGCATAACTCA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Mauro MS, Celma G, Zimyanin V, Magaj MM, Gibson KH, Redemann S, Bahmanyar S. Ndc1 drives nuclear pore complex assembly independent of membrane biogenesis to promote nuclear formation and growth. Elife 2022 11
[ PubMed ID = 35852146 ]
[ RRC reference ]
|
Askjaer P, Galy V, Meister P. Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans. Methods Cell Biol 2014 122 277-310
[ PubMed ID = 24857735 ]
[ RRC reference ]
|
Ródenas E, Klerkx EP, Ayuso C, Audhya A, Askjaer P. Early embryonic requirement for nucleoporin Nup35/NPP-19 in nuclear assembly. Dev Biol 2009 327(2) 399-409
[ PubMed ID = 19146848 ]
[ RRC reference ]
|
|