Allele Name | tm2869 |
Allele Type | 通常株 |
Sequence Name | Y20F4.2 |
Gene Name | crtc-1 |
Worm Base | Allele Name |
tm2869
|
Gene Name |
crtc-1
|
Sequence |
Y20F4.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. T. Katada: shows survival rate similar to N2 during L1 diapause. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 31153/31154-31461/31462 (308 bp deletion) |
Chromosome | I |
Putative gene structure | join(25635..25736, 27047..27124, 27428..27559, 27611..27816, 28896..29195, 30872..31349, 32497..32622) |
Map position | -12 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GTCGTGTACTCCACAATGAC,IntFwd:AGATATGGCCTGGCCTAGTC,ExtRev:GGGCCACGTGGTGTCAGAAT,IntRev:GTGAGGGGCTGTTCCATTAC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Feldmann KG, Chowdhury A, Becker JL, McAlpin N, Ahmed T, Haider S, Richard Xia JX, Diaz K, Mehta MG, Mano I. Non-canonical activation of CREB mediates neuroprotection in a Caenorhabditis elegans model of excitotoxic necrosis. J Neurochem 2019 148(4) 531-549
[ PubMed ID = 30447010 ]
[ RRC reference ]
|
Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL. A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling. Dev Cell 2016 39(2) 209-223
[ PubMed ID = 27720609 ]
[ RRC reference ]
|
Li W, Bell HW, Ahnn J, Lee SK. Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans. J Mol Biol 2015 427(22) 3457-3468
[ PubMed ID = 26232604 ]
[ RRC reference ]
|
|