| Allele Name | tm2869 |
| Allele Type | 通常株 |
| Sequence Name | Y20F4.2 |
| Gene Name | crtc-1 |
| Worm Base | Allele Name |
tm2869
|
| Gene Name |
crtc-1
|
| Sequence |
Y20F4.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. T. Katada: shows survival rate similar to N2 during L1 diapause. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 31153/31154-31461/31462 (308 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(25635..25736, 27047..27124, 27428..27559, 27611..27816, 28896..29195, 30872..31349, 32497..32622) |
| Map position | -12 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GTCGTGTACTCCACAATGAC,IntFwd:AGATATGGCCTGGCCTAGTC,ExtRev:GGGCCACGTGGTGTCAGAAT,IntRev:GTGAGGGGCTGTTCCATTAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Feldmann KG, Chowdhury A, Becker JL, McAlpin N, Ahmed T, Haider S, Richard Xia JX, Diaz K, Mehta MG, Mano I.
Non-canonical activation of CREB mediates neuroprotection in a Caenorhabditis elegans model of excitotoxic necrosis.
J Neurochem 2019 148(4) 531-549
[ PubMed ID = 30447010 ]
[ RRC reference ]
|
Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell 2016 39(2) 209-223
[ PubMed ID = 27720609 ]
[ RRC reference ]
|
Li W, Bell HW, Ahnn J, Lee SK.
Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans.
J Mol Biol 2015 427(22) 3457-3468
[ PubMed ID = 26232604 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.