Allele Name | tm2868 |
Allele Type | 通常株 |
Sequence Name | C27A2.1 |
Gene Name | smc-5 |
Worm Base | Allele Name |
tm2868
|
Gene Name |
smc-5
|
Sequence |
C27A2.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 10345/10346-10790/10791 (445 bp deletion) |
Chromosome | II |
Putative gene structure | join(9407..9498, 9547..9741, 9797..9929, 9974..10438, 10485..10812, 10861..11012, 11923..12315, 12365..12514, 12563..12838, 13101..13379, 13426..14133, 14181..14240) |
Map position | -2.55 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:GCTCATTACCAGATCGCACT,ExtFwd:TTATCGCCTAGAGCTCAGCT,ExtRev:GGGCATATATACGTCTCCTT,IntRev:GTTGATACCAGCGATAGGCT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Hong Y, Sonneville R, Agostinho A, Meier B, Wang B, Blow JJ, Gartner A. The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis. PLoS Genet 2016 12(3) e1005872
[ PubMed ID = 27010650 ]
[ RRC reference ]
|
Bickel JS, Chen L, Hayward J, Yeap SL, Alkers AE, Chan RC. Structural maintenance of chromosomes (SMC) proteins promote homolog-independent recombination repair in meiosis crucial for germ cell genomic stability. PLoS Genet 2010 6(7) e1001028
[ PubMed ID = 20661436 ]
[ RRC reference ]
|
|