分離済み変異体

tm2864

Allele Nametm2864
BalanceCompleted
OutCrossNot Accepted
Sequence NameF07A5.1a
Gene Nameinx-14
Worm BaseAllele Name tm2864 (x1)
Gene Name inx-14
Sequence F07A5.1a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. D. Greenstein: Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1863/1864-CCAC-2272/2273 (409 bp deletion + 4 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(1620..1657, 1701..1746, 1797..2078, 2125..2376, 2449..2732, 2780..2989, 3033..3219))
Map position1.97
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtRev:GCGGCGAAGCTCTACGAATT,IntRev:TCTACTCACTGGTGCTAAAC,ExtFwd:AGTGAGAGTTGGAGCGGTCT,IntFwd:GCGGTCTGCAACTAGTGGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Starich TA, Hall DH, Greenstein D.
Two classes of gap junction channels mediate soma-germline interactions essential for germline proliferation and gametogenesis in Caenorhabditis elegans.
Genetics 2014 198(3) 1127-53 
[ PubMed ID = 25195067 ] [ RRC reference ]

Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D.
Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans.
Development 2009 136(13) 2211-21 
[ PubMed ID = 19502483 ] [ RRC reference ]

Miyata S, Begun J, Troemel ER, Ausubel FM.
DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans.
Genetics 2008 178(2) 903-18 
[ PubMed ID = 18245330 ] [ RRC reference ]

Miyata S, Begun J, Troemel ER, Ausubel FM.
DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans.
Genetics 2008 178(2) 903-18 
[ PubMed ID = 18245330 ] [ RRC reference ]