| Allele Name | tm2864 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F07A5.1a |
| Gene Name | inx-14 |
| Worm Base | Allele Name |
tm2864
(x1) |
| Gene Name |
inx-14
|
| Sequence |
F07A5.1a
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. D. Greenstein: Ste. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 1863/1864-CCAC-2272/2273 (409 bp deletion + 4 bp insertion) |
| Chromosome | I |
| Putative gene structure | complement(join(1620..1657, 1701..1746, 1797..2078, 2125..2376, 2449..2732, 2780..2989, 3033..3219)) |
| Map position | 1.97 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtRev:GCGGCGAAGCTCTACGAATT,IntRev:TCTACTCACTGGTGCTAAAC,ExtFwd:AGTGAGAGTTGGAGCGGTCT,IntFwd:GCGGTCTGCAACTAGTGGGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Starich TA, Hall DH, Greenstein D. Two classes of gap junction channels mediate soma-germline interactions essential for germline proliferation and gametogenesis in Caenorhabditis elegans. Genetics 2014 198(3) 1127-53
[ PubMed ID = 25195067 ]
[ RRC reference ]
|
Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D. Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans. Development 2009 136(13) 2211-21
[ PubMed ID = 19502483 ]
[ RRC reference ]
|
Miyata S, Begun J, Troemel ER, Ausubel FM. DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans. Genetics 2008 178(2) 903-18
[ PubMed ID = 18245330 ]
[ RRC reference ]
|
Miyata S, Begun J, Troemel ER, Ausubel FM. DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans. Genetics 2008 178(2) 903-18
[ PubMed ID = 18245330 ]
[ RRC reference ]
|
|