分離済み変異体

tm2863

Allele Nametm2863
BalanceNot Required
OutCrossNot Accepted
Sequence NameY43F8C.10
Gene Namedmd-3
Worm BaseAllele Name tm2863
Gene Name dmd-3
Sequence Y43F8C.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. D. Portman: males have a partially unretracted tail tip.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 57290/57291-ACGTCGTTCC-57697/57698 (407 bp deletion + 10 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(53723..53904, 54886..55122, 57529..57847, 58339..58552, 58613..58656))
Map position22.56
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCAGAGATACAGCGGGTCA,IntFwd:CGGGTCAAAGTTTAGAGGCT,ExtRev:TCGCCGCAACTTCAACTCAT,IntRev:CCGCGAGAAACGCAAGAATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Serrano-Saiz E, Oren-Suissa M, Bayer EA, Hobert O.
Sexually Dimorphic Differentiation of a C. elegans Hub Neuron Is Cell Autonomously Controlled by a Conserved Transcription Factor.
Curr Biol 2017 27(2) 199-209 
[ PubMed ID = 28065609 ] [ RRC reference ]

Siehr MS, Koo PK, Sherlekar AL, Bian X, Bunkers MR, Miller RM, Portman DS, Lints R.
Multiple doublesex-related genes specify critical cell fates in a C. elegans male neural circuit.
PLoS One 2011 6(11) e26811 
[ PubMed ID = 22069471 ] [ RRC reference ]

Mason DA, Rabinowitz JS, Portman DS.
dmd-3, a doublesex-related gene regulated by tra-1, governs sex-specific morphogenesis in C. elegans.
Development 2008 135(14) 2373-82 
[ PubMed ID = 18550714 ] [ RRC reference ]