分離済み変異体

tm2862

Allele Nametm2862
BalanceNot Required
OutCrossNot Accepted
Sequence NameY56A3A.29
Gene Nameung-1
Worm BaseAllele Name tm2862
Gene Name ung-1
Sequence Y56A3A.29
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 139479/139480-139772/139773 (293 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(137824..137940, 139514..140186, 140232..140290))
Map position13.61
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCGACACAACACGGTGCGT,IntFwd:GACACAACACGGTGCGTTCC,IntRev:GTTCCTCAAAGCATCCGCTG,ExtRev:GACTGTAAGAATTCCGGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752 
[ PubMed ID = 39966347 ] [ RRC reference ]

Nicolai MM, Weishaupt AK, Baesler J, Brinkmann V, Wellenberg A, Winkelbeiner N, Gremme A, Aschner M, Fritz G, Schwerdtle T, Bornhorst J.
Effects of Manganese on Genomic Integrity in the Multicellular Model Organism Caenorhabditis elegans.
Int J Mol Sci 2021 22(20)  
[ PubMed ID = 34681565 ] [ RRC reference ]

Miyaji M, Hayashi Y, Funakoshi M, Tanaka A, Zhang-Akiyama QM.
AP endonuclease EXO-3 deficiency causes developmental delay and abnormal vulval organogenesis, Pvl, through DNA glycosylase-initiated checkpoint activation in Caenorhabditis elegans.
Sci Rep 2018 8(1) 16736 
[ PubMed ID = 30425296 ] [ RRC reference ]

Papaluca A, Wagner JR, Saragovi HU, Ramotar D.
UNG-1 and APN-1 are the major enzymes to efficiently repair 5-hydroxymethyluracil DNA lesions in C. elegans.
Sci Rep 2018 8(1) 6860 
[ PubMed ID = 29717169 ] [ RRC reference ]

Kato Y, Moriwaki T, Funakoshi M, Zhang-Akiyama QM.
Caenorhabditis elegans EXO-3 contributes to longevity and reproduction: differential roles in somatic cells and germ cells.
Mutat Res 2015 772 46-54 
[ PubMed ID = 25772110 ] [ RRC reference ]

Skjeldam HK, Kassahun H, Fensgård O, SenGupta T, Babaie E, Lindvall JM, Arczewska K, Nilsen H.
Loss of Caenorhabditis elegans UNG-1 uracil-DNA glycosylase affects apoptosis in response to DNA damaging agents.
DNA Repair (Amst) 2010 9(8) 861-70 
[ PubMed ID = 20493785 ] [ RRC reference ]

Nakamura N, Morinaga H, Kikuchi M, Yonekura S, Ishii N, Yamamoto K, Yonei S, Zhang QM.
Cloning and characterization of uracil-DNA glycosylase and the biological consequences of the loss of its function in the nematode Caenorhabditis elegans.
Mutagenesis 2008 23(5) 407-13 
[ PubMed ID = 18524757 ] [ RRC reference ]