分離済み変異体

tm2842

Allele Name

tm2842

Allele Type

通常株

Sequence Name

C47D12.8

Gene Name

C47D12.8

Worm Base

Allele Name

tm2842

Gene Name

C47D12.8

Sequence

C47D12.8

Phenotype

homozygous viable

Mutation site

41906/41907-42249/42250 (343 bp deletion)

Chromosome

Putative gene structure

join(41254..41693, 41749..42488, 43003..43379, AL033535.1:1522..1611, AL033535.1:1657..1782, AL033535.1:2423..2560, AL033535.1:2611..2760, AL033535.1:3507..3593, AL033535.1:3644..3748, AL033535.1:4489..4704, AL033535.1:5005..5220, AL033535.1:6083..6205)

Map position

3.97

Balancer

Map position of balancer

Sequence of primers

IntRev:GTACTGTCCATTTCGCAGGA,ExtRev:GAATCTCCGAGAGTACTGTC,ExtFwd:ATCGACGTCTCCTGGCCCTA,IntFwd:GGCCCTAGTTCTCAATACAA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752
[ PubMed ID = 39966347 ] [ RRC reference ]

Ananthaswamy D, Funes K, Borges T, Roques S, Fassnacht N, Jamal SE, Checchi PM, Wei-Sy Lee T.
NuRD chromatin remodeling is required to repair exogenous DSBs in the Caenorhabditis elegans germline.
bioRxiv 2024
[ PubMed ID = 39314477 ] [ RRC reference ]

Muniesa-Vargas A, Davó-Martínez C, Ribeiro-Silva C, van der Woude M, Thijssen KL, Haspels B, Häckes D, Kaynak ÜU, Kanaar R, Marteijn JA, Theil AF, Kuijten MMP, Vermeulen W, Lans H.
Persistent TFIIH binding to non-excised DNA damage causes cell and developmental failure.
Nat Commun 2024 15(1) 3490
[ PubMed ID = 38664429 ] [ RRC reference ]

Hicks T, Koury E, McCabe C, Williams C, Crahan C, Smolikove S.
R-loop-induced irreparable DNA damage evades checkpoint detection in the C. elegans germline.
Nucleic Acids Res 2022 50(14) 8041-8059
[ PubMed ID = 35871299 ] [ RRC reference ]

Dello Stritto MR, Bauer B, Barraud P, Jantsch V.
DNA topoisomerase 3 is required for efficient germ cell quality control.
J Cell Biol 2021 220(6)
[ PubMed ID = 33798260 ] [ RRC reference ]

Gurkar AU, Robinson AR, Cui Y, Li X, Allani SK, Webster A, Muravia M, Fallahi M, Weissbach H, Robbins PD, Wang Y, Kelley EE, Croix CMS, Niedernhofer LJ, Gill MS.
Dysregulation of DAF-16/FOXO3A-mediated stress responses accelerates oxidative DNA damage induced aging.
Redox Biol 2018 18 191-199
[ PubMed ID = 30031267 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002
[ PubMed ID = 27669035 ] [ RRC reference ]

Imanikia S, Galea F, Nagy E, Phillips DH, Stürzenbaum SR, Arlt VM.
The application of the comet assay to assess the genotoxicity of environmental pollutants in the nematode Caenorhabditis elegans.
Environ Toxicol Pharmacol 2016 45 356-61
[ PubMed ID = 27389785 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885
[ PubMed ID = 29046436 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480
[ PubMed ID = 28934497 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864
[ PubMed ID = 28634159 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795
[ PubMed ID = 22091407 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet 2013 9(7) e1003582
[ PubMed ID = 23874209 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ 2013 20(12) 1709-18
[ PubMed ID = 24013725 ] [ RRC reference ]

Agostinho A, Meier B, Sonneville R, Jagut M, Woglar A, Blow J, Jantsch V, Gartner A.
Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS-81 and XPF-1 nucleases.
PLoS Genet 2013 9(7) e1003591
[ PubMed ID = 23901331 ] [ RRC reference ]