分離済み変異体

tm2828

Allele Nametm2828
BalanceNot Required
OutCrossNot Accepted
Sequence NameT26A5.5
Gene NameT26A5.5
Worm BaseAllele Name tm2828
Gene Name T26A5.5
Sequence T26A5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Han: fertile, wild-type growth and normal vulval development.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7719/7720-8017/8018 (298 bp deletion)
ChromosomeIII
Putative gene structurejoin(6859..6953, 7002..7133, 7184..7760, 7809..8058, 8177..8311, 8357..8433, 8489..8731, 9573..9617, 9682..10458, 10510..10702, 10759..11168, 11217..11428, 11477..11561)
Map position-1.25
Balancer
Map position of balancer
Sequence of primersIntFwd:TCCCTCACCAGATTTCTCAG,ExtFwd:TGGACTTGACAACCCGATAC,IntRev:ACGACAGTTTGAGGCCATAG,ExtRev:ATCGCGCGTTTCGCAGTACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Zaghet N, Madsen K, Rossi F, Perez DF, Amendola PG, Demharter S, Pfisterer U, Khodosevich K, Pasini D, Salcini AE.
Coordinated maintenance of H3K36/K27 methylation by histone demethylases preserves germ cell identity and immortality.
Cell Rep 2021 37(8) 110050 
[ PubMed ID = 34818537 ] [ RRC reference ]