| Allele Name | tm2821 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | C40H1.1 |
| Gene Name | cpb-1 |
| Worm Base | Allele Name |
tm2821
(x1) |
| Gene Name |
cpb-1
|
| Sequence |
C40H1.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 14589/14590-15091/15092 (502 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(14148..14361, 14409..14519, 14567..14657, 14715..15054, 15103..15318, 15373..15519) |
| Map position | 0.41 |
| Balancer | hT2 |
| Map position of balancer | |
| Sequence of primers | IntFwd:TGCAACGACGCGAATCGTAT,ExtRev:CAGTGCGCACCATTGGATAA,IntRev:ATATGCATGCGATCCCAACA,ExtFwd:TACAACCAGCGGTTCCCACA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Singh KD, Zheng X, Milstein S, Keller M, Roschitzki B, Grossmann J, Hengartner MO.
Differential regulation of germ line apoptosis and germ cell differentiation by CPEB family members in C. elegans.
PLoS One 2017 12(7) e0182270
[ PubMed ID = 28759574 ]
[ RRC reference ]
|
Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv Exp Med Biol 2013 757 41-69
[ PubMed ID = 22872474 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.