分離済み変異体

tm2816

Allele Nametm2816
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK455.9
Gene Namemir-254
Worm BaseAllele Name tm2816
Gene Name mir-254
Sequence ZK455.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13460/13461-13844/13845 (384 bp deletion)
ChromosomeX
Putative gene structurecomplement(13610..13632)
Map position3.01
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGTGGGAACTCCTGATACA,ExtFwd:TGAGCTCTTCAGGGCGGTGA,ExtRev:TCCTGAAATGAGACCACCGA,IntRev:TCGGACGATGGTCAATGCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Barbelanne M, Lu Y, Kumar K, Zhang X, Li C, Park K, Warner A, Xu XZS, Shaham S, Leroux MR.
C. elegans PPEF-type phosphatase (Retinal degeneration C ortholog) functions in diverse classes of cilia to regulate nematode behaviors.
Sci Rep 2024 14(1) 28347 
[ PubMed ID = 39550471 ] [ RRC reference ]

Reed R, Park K, Waddell B, Timbers TA, Li C, Baxi K, Giacomin RM, Leroux MR, Carvalho CE.
The Caenorhabditis elegans Shugoshin regulates TAC-1 in cilia.
Sci Rep 2023 13(1) 9410 
[ PubMed ID = 37296204 ] [ RRC reference ]

Choi JH, Horowitz LB, Ringstad N.
Opponent vesicular transporters regulate the strength of glutamatergic neurotransmission in a C. elegans sensory circuit.
Nat Commun 2021 12(1) 6334 
[ PubMed ID = 34732711 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

Horowitz LB, Brandt JP, Ringstad N.
Repression of an activity-dependent autocrine insulin signal is required for sensory neuron development in C. elegans.
Development 2019 146(22)  
[ PubMed ID = 31628111 ] [ RRC reference ]

Worthy SE, Rojas GL, Taylor CJ, Glater EE.
Identification of Odor Blend Used by Caenorhabditis elegans for Pathogen Recognition.
Chem Senses 2018 43(3) 169-180 
[ PubMed ID = 29373666 ] [ RRC reference ]

Rojo Romanos T, Petersen JG, Pocock R.
Control of Neuropeptide Expression by Parallel Activity-dependent Pathways in Caenorhabditis elegans.
Sci Rep 2017 7 38734 
[ PubMed ID = 28139692 ] [ RRC reference ]

Brandt JP, Ringstad N.
Toll-like Receptor Signaling Promotes Development and Function of Sensory Neurons Required for a C. elegans Pathogen-Avoidance Behavior.
Curr Biol 2015 25(17) 2228-37 
[ PubMed ID = 26279230 ] [ RRC reference ]

Sharabi K, Charar C, Friedman N, Mizrahi I, Zaslaver A, Sznajder JI, Gruenbaum Y.
The response to high CO2 levels requires the neuropeptide secretion component HID-1 to promote pumping inhibition.
PLoS Genet 2014 10(8) e1004529 
[ PubMed ID = 25101962 ] [ RRC reference ]

Smith ES, Martinez-Velazquez L, Ringstad N.
A chemoreceptor that detects molecular carbon dioxide.
J Biol Chem 2013 288(52) 37071-81 
[ PubMed ID = 24240097 ] [ RRC reference ]

Mohan S, Timbers TA, Kennedy J, Blacque OE, Leroux MR.
Striated rootlet and nonfilamentous forms of rootletin maintain ciliary function.
Curr Biol 2013 23(20) 2016-22 
[ PubMed ID = 24094853 ] [ RRC reference ]

Carrillo MA, Guillermin ML, Rengarajan S, Okubo RP, Hallem EA.
O2-sensing neurons control CO2 response in C. elegans.
J Neurosci 2013 33(23) 9675-83 
[ PubMed ID = 23739964 ] [ RRC reference ]

Liu T, Cai D.
Counterbalance between BAG and URX neurons via guanylate cyclases controls lifespan homeostasis in C. elegans.
EMBO J 2013 32(11) 1529-42 
[ PubMed ID = 23584532 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]