分離済み変異体

tm2806

Allele Nametm2806
BalanceCompleted
OutCrossNot Accepted
Sequence NameC14A4.11
Gene NameC14A4.11
Worm BaseAllele Name tm2806 (x1)
Gene Name C14A4.11
Sequence C14A4.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr.J.M. Schumacher: Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26865/26866-TG-27307/27308 (442 bp deletion + 2 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(26269..26349, 26650..26899, 26955..27154, 27237..27279, 27336..27409))
Map position2.74
BalancermIn1,mIn1 [e128 mIs14]
Map position of balancer
Sequence of primersIntRev:GAGGGTGGATATCTTGGAGC,IntFwd:ACCAGTTGGTTGGCGGACAC,ExtRev:TGCGATGCAAATCGATCGTA,ExtFwd:TGCGGACTATCATTGTCGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Verbeeren J, Teixeira J, Garcia SMDA.
The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism.
PLoS Genet 2023 19(12) e1011109 
[ PubMed ID = 38134228 ] [ RRC reference ]

Koskimäki J, Girard R, Li Y, Saadat L, Zeineddine HA, Lightle R, Moore T, Lyne S, Avner K, Shenkar R, Cao Y, Shi C, Polster SP, Zhang D, Carrión-Penagos J, Romanos S, Fonseca G, Lopez-Ramirez MA, Chapman EM, Popiel E, Tang AT, Akers A, Faber P, Andrade J, Ginsberg M, Derry WB, Kahn ML, Marchuk DA, Awad IA.
Comprehensive transcriptome analysis of cerebral cavernous malformation across multiple species and genotypes.
JCI Insight 2019 4(3)  
[ PubMed ID = 30728328 ] [ RRC reference ]

Pal S, Lant B, Yu B, Tian R, Tong J, Krieger JR, Moran MF, Gingras AC, Derry WB.
CCM-3 Promotes C. elegans Germline Development by Regulating Vesicle Trafficking Cytokinesis and Polarity.
Curr Biol 2017 27(6) 868-876 
[ PubMed ID = 28285997 ] [ RRC reference ]

Lant B, Yu B, Goudreault M, Holmyard D, Knight JD, Xu P, Zhao L, Chin K, Wallace E, Zhen M, Gingras AC, Derry WB.
CCM-3/STRIPAK promotes seamless tube extension through endocytic recycling.
Nat Commun 2015 6 6449 
[ PubMed ID = 25743393 ] [ RRC reference ]