Allele Name | tm2784 |
Allele Type | バランス済 |
Sequence Name | F10G8.3 |
Gene Name | npp-17 |
Worm Base | Allele Name |
tm2784
|
Gene Name |
npp-17
|
Sequence |
F10G8.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. H. Sawa: non Psa. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 9489/9490-9891/9892 (402 bp deletion) |
Chromosome | I |
Putative gene structure | join(8261..8368, 8413..8505, 9369..10202, 11259..11345) |
Map position | 4.55 |
Balancer | hT2 bli-4(e937) let-? qIs48] |
Map position of balancer | |
Sequence of primers | ExtRev:CCTTTGCTCCGCAGAAGGTG,IntRev:CGCAGAAGGTGTACCACCTC,ExtFwd:CCAATTCTAGATATCGCCTG,IntFwd:TCGCCTGGATTGAAGACAGT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Baker ST, Grill B. Defining Minimal Binding Regions in Regulator of Presynaptic Morphology 1 (RPM-1) Using Caenorhabditis elegans Neurons Reveals Differential Signaling Complexes. J Biol Chem 2017 292(6) 2519-2530
[ PubMed ID = 27979965 ]
[ RRC reference ]
|
Grill B, Chen L, Tulgren ED, Baker ST, Bienvenut W, Anderson M, Quadroni M, Jin Y, Garner CC. RAE-1, a novel PHR binding protein, is required for axon termination and synapse formation in Caenorhabditis elegans. J Neurosci 2012 32(8) 2628-36
[ PubMed ID = 22357847 ]
[ RRC reference ]
|
Askjaer P, Galy V, Meister P. Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans. Methods Cell Biol 2014 122 277-310
[ PubMed ID = 24857735 ]
[ RRC reference ]
|
|