| Allele Name | tm2760 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | Y53G8AR.3 |
| Gene Name | ral-1 |
| Worm Base | Allele Name |
tm2760
(x1) |
| Gene Name |
ral-1
|
| Sequence |
Y53G8AR.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 31342/31343-31661/31662 (319 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(31144..31200, 31276..31341, 32350..32471, 32777..32863, 34473..34650, 35947..36078) |
| Map position | -7.29 |
| Balancer | qC1 [e1259 q339 qIs26] |
| Map position of balancer | |
| Sequence of primers | IntFwd:TGCAGGTTATTATGGTCGGA,ExtRev:CCGAAACTCGTTTGTAGCCT,IntRev:CCCTCACCACTTCGATAGTA,ExtFwd:CGTACCCCTCAACTGTCGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Shin H, Braendle C, Monahan KB, Kaplan REW, Zand TP, Mote FS, Peters EC, Reiner DJ. Developmental fidelity is imposed by genetically separable RalGEF activities that mediate opposing signals. PLoS Genet 2019 15(5) e1008056
[ PubMed ID = 31086367 ]
[ RRC reference ]
|
Reiner DJ, Lundquist EA. Small GTPases. WormBook 2018 2018 1-65
[ PubMed ID = 27218782 ]
[ RRC reference ]
|
Zand TP, Reiner DJ, Der CJ. Ras effector switching promotes divergent cell fates in C. elegans vulval patterning. Dev Cell 2011 20(1) 84-96
[ PubMed ID = 21238927 ]
[ RRC reference ]
|
|