分離済み変異体

tm2738

Allele Nametm2738
BalanceNot Required
OutCrossNot Accepted
Sequence NameK02B2.4
Gene Nameinx-7
Worm BaseAllele Name tm2738
Gene Name inx-7
Sequence K02B2.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Bargmann: healthy, may have a slightly reduced brood size. Dr. C-F. Chuang: normal AWC signaling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8342/8343-A-8677/8678 (335 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(7891..8169, 8225..8372, 8422..8578, 8625..8761, 8809..9039, 9583..9716, 9766..10350))
Map position2.64
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTGAGTGAAAGCCGGGGAT,IntFwd:GGGATGCAGTGTGAGCCAGT,ExtRev:GATACATGCTCCCACATGAT,IntRev:GCTCCCACATGATCGTCAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P.
Locomotion modulates olfactory learning through proprioception in C. elegans.
Nat Commun 2023 14(1) 4534 
[ PubMed ID = 37500635 ] [ RRC reference ]

Liu P, Chen B, Wang ZW.
GABAergic motor neurons bias locomotor decision-making in C. elegans.
Nat Commun 2020 11(1) 5076 
[ PubMed ID = 33033264 ] [ RRC reference ]

Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI.
Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272 
[ PubMed ID = 28143932 ] [ RRC reference ]