| Allele Name | tm2738 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K02B2.4 |
| Gene Name | inx-7 |
| Worm Base | Allele Name |
tm2738
|
| Gene Name |
inx-7
|
| Sequence |
K02B2.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C. Bargmann: healthy, may have a slightly reduced brood size. Dr. C-F. Chuang: normal AWC signaling. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 8342/8343-A-8677/8678 (335 bp deletion + 1 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(7891..8169, 8225..8372, 8422..8578, 8625..8761, 8809..9039, 9583..9716, 9766..10350)) |
| Map position | 2.64 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GGTGAGTGAAAGCCGGGGAT,IntFwd:GGGATGCAGTGTGAGCCAGT,ExtRev:GATACATGCTCCCACATGAT,IntRev:GCTCCCACATGATCGTCAAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P. Locomotion modulates olfactory learning through proprioception in C. elegans. Nat Commun 2023 14(1) 4534
[ PubMed ID = 37500635 ]
[ RRC reference ]
|
Liu P, Chen B, Wang ZW. GABAergic motor neurons bias locomotor decision-making in C. elegans. Nat Commun 2020 11(1) 5076
[ PubMed ID = 33033264 ]
[ RRC reference ]
|
Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI. Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272
[ PubMed ID = 28143932 ]
[ RRC reference ]
|
|