分離済み変異体

tm272

Allele Nametm272
BalanceNot Required
OutCrossNot Accepted
Sequence NameC33D12.7
Gene Nameceh-30
Worm BaseAllele Name tm272
Gene Name ceh-30
Sequence C33D12.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Sengupta: normal development of AWA neurons.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22743/22744-23199/23200 (456 bp deletion)
ChromosomeX
Putative gene structurejoin(21713..21880, 21949..22150, 22427..22682, 23349..23622)
Map position-11.91
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGCGCCCAATATTTTACGC,ExtRev:TTCTGAACTGCGGAGAGGTT,IntFwd:GGACGGAACGATCATCTTGT,IntRev:CCTGTCGCTTCCATTTTGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Reilly DK, McGlame EJ, Vandewyer E, Robidoux AN, Muirhead CS, Northcott HT, Joyce W, Alkema MJ, Gegear RJ, Beets I, Srinivasan J.
Distinct neuropeptide-receptor modules regulate a sex-specific behavioral response to a pheromone.
Commun Biol 2021 4(1) 1018 
[ PubMed ID = 34465863 ] [ RRC reference ]

Sakai N, Iwata R, Yokoi S, Butcher RA, Clardy J, Tomioka M, Iino Y.
A sexually conditioned switch of chemosensory behavior in C. elegans.
PLoS One 2013 8(7) e68676 
[ PubMed ID = 23861933 ] [ RRC reference ]

Srinivasan J, Kaplan F, Ajredini R, Zachariah C, Alborn HT, Teal PE, Malik RU, Edison AS, Sternberg PW, Schroeder FC.
A blend of small molecules regulates both mating and development in Caenorhabditis elegans.
Nature 2008 454(7208) 1115-8 
[ PubMed ID = 18650807 ] [ RRC reference ]

Peden E, Kimberly E, Gengyo-Ando K, Mitani S, Xue D.
Control of sex-specific apoptosis in C. elegans by the BarH homeodomain protein CEH-30 and the transcriptional repressor UNC-37/Groucho.
Genes Dev 2007 21(23) 3195-207 
[ PubMed ID = 18056429 ] [ RRC reference ]