分離済み変異体

tm2715

Allele Nametm2715
BalanceNot Required
OutCrossNot Accepted
Sequence NameC02F5.4
Gene Namecids-1
Worm BaseAllele Name tm2715
Gene Name cids-1
Sequence C02F5.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Han: fertile, wild-type growth and normal vulval development. Dr. T. Blumenthal: at 15 C: ~11% dead egg phenotype, at 20 C: brood size normal and no embryo lethality, at 25 C; ~32% dead egg phenotype and ~4% male. Dr. T. Blumentahal: PNAS 105, 16665 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18178/18179-18721/18722 (543 bp deletion)
ChromosomeIII
Putative gene structurejoin(17980..18117, 18161..18294, 18337..18520, 18730..18812, 18865..19012, 19061..19159)
Map position-0.35
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCACATCGAACTATACGAC,IntFwd:CACCCTTCCTCAATTCAGAC,ExtRev:CGATCTTCTCTACGCTTAAC,IntRev:CATATTCCTCCAGCATCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev 2015 29(22) 2377-90 
[ PubMed ID = 26588990 ] [ RRC reference ]

Cui M, Allen MA, Larsen A, Macmorris M, Han M, Blumenthal T.
Genes involved in pre-mRNA 3'-end formation and transcription termination revealed by a lin-15 operon Muv suppressor screen.
Proc Natl Acad Sci U S A 2008 105(43) 16665-70 
[ PubMed ID = 18946043 ] [ RRC reference ]