| Allele Name | tm2713 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | H27M09.3 |
| Gene Name | syp-4 |
| Worm Base | Allele Name |
tm2713
(x1) |
| Gene Name |
syp-4
|
| Sequence |
H27M09.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. M.P. Colaiacovo: PLoS Genetics 5, 10, e1000669 (2009). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 5648/5649-5861/5862 (213 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(5521..5586, 5632..5728, 5775..5943, 6014..6297, 6353..6558, 6620..7199, 7246..7389, 7436..7707) |
| Map position | 1.39 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AATGTCGTTTCCGACGCTAC,ExtRev:TCTCCCGCTGATGTACCCTT,IntFwd:CTGCGATGCCATGAGGTATT,IntRev:CGCTGATGTACCCTTGCTAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Köhler S, Wojcik M, Xu K, Dernburg AF.
Dynamic molecular architecture of the synaptonemal complex.
Sci Adv 2025 11(4) eadq9374
[ PubMed ID = 39841849 ]
[ RRC reference ]
|
Gros O, Passmore JB, Borst NO, Kutra D, Nijenhuis W, Fuqua T, Kapitein LC, Crocker JM, Kreshuk A, Köhler S.
Spherical harmonics texture extraction for versatile analysis of biological objects.
PLoS Comput Biol 2025 21(1) e1012349
[ PubMed ID = 39879256 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997
[ PubMed ID = 27605049 ]
[ RRC reference ]
|
Jaramillo-Lambert A, Fuchsman AS, Fabritius AS, Smith HE, Golden A.
Rapid and Efficient Identification of Caenorhabditis elegans Legacy Mutations Using Hawaiian SNP-Based Mapping and Whole-Genome Sequencing.
G3 (Bethesda) 2015 5(5) 1007-19
[ PubMed ID = 25740937 ]
[ RRC reference ]
|
Smolikov S, Schild-Prüfert K, Colaiácovo MP.
A yeast two-hybrid screen for SYP-3 interactors identifies SYP-4, a component required for synaptonemal complex assembly and chiasma formation in Caenorhabditis elegans meiosis.
PLoS Genet 2009 5(10) e1000669
[ PubMed ID = 19798442 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.