Allele Name | tm2711 |
Allele Type | 通常株 |
Sequence Name | H02I12.8 |
Gene Name | cyp-31A2 |
Worm Base | Allele Name |
tm2711
|
Gene Name |
cyp-31A2
|
Sequence |
H02I12.8
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 32980/32981-33455/33456 (475 bp deletion) |
Chromosome | IV |
Putative gene structure | join(32671..32763, 32810..33210, 33254..33350, 33397..33467, 33540..34087, Z68336.1:5..171, Z68336.1:489..575) |
Map position | 4.98 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:AGGTTTTGCAATGGGGGTCA,ExtRev:CGGGTCGAATACATCAGGAT,IntFwd:CCCCGCTGTACTTCTCGCTA,IntRev:CACGGTGAACAAGGTACAGG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Stein KK, Golden A. The C. elegans eggshell. WormBook 2018 2018 1-36
[ PubMed ID = 26715360 ]
[ RRC reference ]
|
Hoang HD, Prasain JK, Dorand D, Miller MA. A heterogeneous mixture of F-series prostaglandins promotes sperm guidance in the Caenorhabditis elegans reproductive tract. PLoS Genet 2013 9(1) e1003271
[ PubMed ID = 23382703 ]
[ RRC reference ]
|
Benenati G, Penkov S, Müller-Reichert T, Entchev EV, Kurzchalia TV. Two cytochrome P450s in Caenorhabditis elegans are essential for the organization of eggshell, correct execution of meiosis and the polarization of embryo. Mech Dev 2009 126(5-6) 382-93
[ PubMed ID = 19368796 ]
[ RRC reference ]
|
|