Allele Name | tm2707 |
Allele Type | バランス済 |
Sequence Name | F59B10.1 |
Gene Name | pqn-47 |
Worm Base | Allele Name |
tm2707
|
Gene Name |
pqn-47
|
Sequence |
F59B10.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 29324/29325-GGTGATATCCGT-29882/29883 (558 bp deletion + 12 bp insertion) |
Chromosome | II |
Putative gene structure | complement(join(Z49132.1:27661..28000, Z49132.1:28370..28518, Z49132.1:28563..28683, Z49132.1:28734..28981, Z49132.1:29062..29192, Z49132.1:29240..30491, 52..711, 1059..1252, 2489..2513)) |
Map position | 2.98 |
Balancer | mIn1 |
Map position of balancer | |
Sequence of primers | IntFwd:TCTACAACGGGCGGCGTATC,ExtRev:AACGTGGAAGCTTCCGATAC,IntRev:TGCCACCAAAGTACGTTAAC,ExtFwd:TGTGTAGCGATGGCTCTACT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Meng J, Ma X, Tao H, Jin X, Witvliet D, Mitchell J, Zhu M, Dong MQ, Zhen M, Jin Y, Qi YB. Myrf ER-Bound Transcription Factors Drive C. elegans Synaptic Plasticity via Cleavage-Dependent Nuclear Translocation. Dev Cell 2017 41(2) 180-194.e7
[ PubMed ID = 28441531 ]
[ RRC reference ]
|
Russel S, Frand AR, Ruvkun G. Regulation of the C. elegans molt by pqn-47. Dev Biol 2011 360(2) 297-309
[ PubMed ID = 21989027 ]
[ RRC reference ]
|
|