分離済み変異体

tm2706

Allele Name

tm2706

Allele Type

通常株

Sequence Name

K02G10.4a

Gene Name

flp-11

Worm Base

Allele Name

tm2706

Gene Name

flp-11

Sequence

K02G10.4a

Phenotype

homozygous viable

Mutation site

4360/4361-4514/4515 (154 bp deletion)

Chromosome

Putative gene structure

complement(join(4206..4291, 4361..4527, 4583..4662))

Map position

-6.9

Balancer

Map position of balancer

Sequence of primers

IntRev:GCATTGGCACTTCTCCTTAT,ExtRev:ACGCCCCCTCCTAATACATC,IntFwd:GGTCGTCCTCGGTCATTACT,ExtFwd:TCGCCTCAGGAGTTGTTCGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Ren J, Sang Y, Aballay A.
Cholinergic receptor-Wnt pathway controls immune activation by sensing intestinal dysfunction.
Cell Rep 2022 41(5) 111575
[ PubMed ID = 36323254 ] [ RRC reference ]

Cockx B, Van Bael S, Boelen R, Vandewyer E, Yang H, Le TA, Dalzell JJ, Beets I, Ludwig C, Lee J, Temmerman L.
Mass Spectrometry-Driven Discovery of Neuropeptides Mediating Nictation Behavior of Nematodes.
Mol Cell Proteomics 2023 22(2) 100479
[ PubMed ID = 36481452 ] [ RRC reference ]

Busack I, Bringmann H.
A sleep-active neuron can promote survival while sleep behavior is disturbed.
PLoS Genet 2023 19(3) e1010665
[ PubMed ID = 36917595 ] [ RRC reference ]

Ardiel EL, Lauziere A, Xu S, Harvey BJ, Christensen RP, Nurrish S, Kaplan JM, Shroff H.
Stereotyped behavioral maturation and rhythmic quiescence in C. elegans embryos.
Elife 2022 11
[ PubMed ID = 35929725 ] [ RRC reference ]

Makino M, Ulzii E, Shirasaki R, Kim J, You YJ.
Regulation of Satiety Quiescence by Neuropeptide Signaling in Caenorhabditis elegans.
Front Neurosci 2021 15 678590
[ PubMed ID = 34335159 ] [ RRC reference ]

Bayer EA, Liberatore KM, Schneider JR, Schlesinger E, He Z, Birnbaum S, Wightman B.
Insulin signaling and osmotic stress response regulate arousal and developmental progression of C. elegans at hatching.
Genetics 2022 220(1)
[ PubMed ID = 34788806 ] [ RRC reference ]

Steuer Costa W, Van der Auwera P, Glock C, Liewald JF, Bach M, Schüler C, Wabnig S, Oranth A, Masurat F, Bringmann H, Schoofs L, Stelzer EHK, Fischer SC, Gottschalk A.
A GABAergic and peptidergic sleep neuron as a locomotion stop neuron with compartmentalized Ca2+ dynamics.
Nat Commun 2019 10(1) 4095
[ PubMed ID = 31506439 ] [ RRC reference ]

Maluck E, Busack I, Besseling J, Masurat F, Turek M, Busch KE, Bringmann H.
A wake-active locomotion circuit depolarizes a sleep-active neuron to switch on sleep.
PLoS Biol 2020 18(2) e3000361
[ PubMed ID = 32078631 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6
[ PubMed ID = 30146306 ] [ RRC reference ]

Turek M, Besseling J, Spies JP, König S, Bringmann H.
Sleep-active neuron specification and sleep induction require FLP-11 neuropeptides to systemically induce sleep.
Elife 2016 5
[ PubMed ID = 26949257 ] [ RRC reference ]

Lee JS, Shih PY, Schaedel ON, Quintero-Cadena P, Rogers AK, Sternberg PW.
FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system.
Proc Natl Acad Sci U S A 2017 114(50) E10726-E10735
[ PubMed ID = 29167374 ] [ RRC reference ]

Banerjee N, Bhattacharya R, Gorczyca M, Collins KM, Francis MM.
Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior.
PLoS Genet 2017 13(4) e1006697
[ PubMed ID = 28384151 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472
[ PubMed ID = 23658528 ] [ RRC reference ]