分離済み変異体

tm2705

Allele Nametm2705
BalanceNot Required
OutCrossNot Accepted
Sequence NameR148.1
Gene Namemks-1
Worm BaseAllele Name tm2705
Gene Name mks-1
Sequence R148.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr.K. Oegema: wild-type dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21291/21292-21481/21482 (190 bp deletion)
ChromosomeIII
Putative gene structurejoin(20702..20760, 21090..21236, 21298..21405, 21460..21567, 22425..22608, 23183..23258, 23309..23600, 24153..24255, 24309..24353, 25110..25373)
Map position-7.44
Balancer
Map position of balancer
Sequence of primersIntRev:CTCAATGTCCATTGGGCCCA,ExtRev:AGCCCCCACTCCGTTCAATA,IntFwd:GTGATCGATGAGAGACCATC,ExtFwd:AGGGAGCGTCAAATTAACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wei Q, Zhang Y, Schouteden C, Zhang Y, Zhang Q, Dong J, Wonesch V, Ling K, Dammermann A, Hu J.
The hydrolethalus syndrome protein HYLS-1 regulates formation of the ciliary gate.
Nat Commun 2016 7 12437 
[ PubMed ID = 27534274 ] [ RRC reference ]

Masyukova SV, Landis DE, Henke SJ, Williams CL, Pieczynski JN, Roszczynialski KN, Covington JE, Malarkey EB, Yoder BK.
A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4.
PLoS Genet 2016 12(2) e1005841 
[ PubMed ID = 26863025 ] [ RRC reference ]

Yee LE, Garcia-Gonzalo FR, Bowie RV, Li C, Kennedy JK, Ashrafi K, Blacque OE, Leroux MR, Reiter JF.
Conserved Genetic Interactions between Ciliopathy Complexes Cooperatively Support Ciliogenesis and Ciliary Signaling.
PLoS Genet 2015 11(11) e1005627 
[ PubMed ID = 26540106 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J Cell Sci 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]

Williams CL, Masyukova SV, Yoder BK.
Normal ciliogenesis requires synergy between the cystic kidney disease genes MKS-3 and NPHP-4.
J Am Soc Nephrol 2010 21(5) 782-93 
[ PubMed ID = 20150540 ] [ RRC reference ]

Bialas NJ, Inglis PN, Li C, Robinson JF, Parker JD, Healey MP, Davis EE, Inglis CD, Toivonen T, Cottell DC, Blacque OE, Quarmby LM, Katsanis N, Leroux MR.
Functional interactions between the ciliopathy-associated Meckel syndrome 1 (MKS1) protein and two novel MKS1-related (MKSR) proteins.
J Cell Sci 2009 122(Pt 5) 611-24 
[ PubMed ID = 19208769 ] [ RRC reference ]

Williams CL, Winkelbauer ME, Schafer JC, Michaud EJ, Yoder BK.
Functional redundancy of the B9 proteins and nephrocystins in Caenorhabditis elegans ciliogenesis.
Mol Biol Cell 2008 19(5) 2154-68 
[ PubMed ID = 18337471 ] [ RRC reference ]