| Allele Name | tm2697 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | ZK1128.2 |
| Gene Name | mett-10 |
| Worm Base | Allele Name |
tm2697
|
| Gene Name |
mett-10
|
| Sequence |
ZK1128.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. T. Schedl: in frame deletion. Strain is a ts sterile/Pvl. At 20 C, the strain is fertile with about 10% penetrance of the Pvl. At 25 C, the strain is 100% sterile, with close to 90% penetrance of the Pvl. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 4946/4947-5503/5504 (557 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(4106..4306, 4377..4676, 4731..4996, 5047..5215, 5264..5767) |
| Map position | 1.84 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntFwd:GCGATGCATAACCGGGTGGT,ExtRev:GCACTAGTTGATGAAGGTGT,IntRev:GAATGATCGGGCCAGGAACT,ExtFwd:CAACTGTGATCGGCCCGGAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Dorsett M, Schedl T.
A role for dynein in the inhibition of germ cell proliferative fate.
Mol Cell Biol 2009 29(22) 6128-39
[ PubMed ID = 19752194 ]
[ RRC reference ]
|
Dorsett M, Westlund B, Schedl T.
METT-10, a putative methyltransferase, inhibits germ cell proliferative fate in Caenorhabditis elegans.
Genetics 2009 183(1) 233-47
[ PubMed ID = 19596901 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.