| Allele Name | tm2685 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | Y57A10A.15 |
| Gene Name | polg-1 |
| Worm Base | Allele Name |
tm2685
(x1) |
| Gene Name |
polg-1
|
| Sequence |
Y57A10A.15
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 62921/62922-63407/63408 (486 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(53507..53659, 53863..54090, 54916..55216, 56472..56874, 57618..57988, 59080..59628, 61225..61582, 61709..61793, 62568..63020, 63272..63589)) |
| Map position | 6.94 |
| Balancer | mnC1 [dpy-10(e128) unc52(e444) nIs190 let-?],rol-1 (e91) |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GATAAGCCTCCCGACATCTG,IntFwd:CCCGACATCTGGCTCGATCA,ExtRev:GCGTCCTCCGAAAATAATGC,IntRev:CCACGTATCCCGCCGACAAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Meyrick J, Stefanetti RJ, Errington L, McFarland R, Gorman GS, Lax NZ.
Model systems informing mechanisms and drug discovery: a review of POLG-related disease models.
Wellcome Open Res 2023 8 33
[ PubMed ID = 41199776 ]
[ RRC reference ]
|
Hench J, Bratić Hench I, Pujol C, Ipsen S, Brodesser S, Mourier A, Tolnay M, Frank S, Trifunović A.
A tissue-specific approach to the analysis of metabolic changes in Caenorhabditis elegans.
PLoS One 2011 6(12) e28417
[ PubMed ID = 22162770 ]
[ RRC reference ]
|
Bratic I, Hench J, Trifunovic A.
Caenorhabditis elegans as a model system for mtDNA replication defects.
Methods 2010 51(4) 437-43
[ PubMed ID = 20230897 ]
[ RRC reference ]
|
Sugimoto T, Mori C, Takanami T, Sasagawa Y, Saito R, Ichiishi E, Higashitani A.
Caenorhabditis elegans par2.1/mtssb-1 is essential for mitochondrial DNA replication and its defect causes comprehensive transcriptional alterations including a hypoxia response.
Exp Cell Res 2008 314(1) 103-14
[ PubMed ID = 17900564 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.